Header
Research Article
Over Expression of Novel Ubiquitin - Conjugating Enzyme Ube2q2l (E330021D16) Causes Cell Growth Delay/Arrest through Inducing DNA Damage
Jianjun Hu1,2#*, Yixuan Wang1 and Shaorong Gao1#*
1The National Institute of Biological Sciences (NIBS), Beijing, China
2Department of Neurology, Beth Israel Deaconess Medical Center and Harvard Medical School, USA
#Both authors contribute equally

ABSTRACT
A great amount of previously unidentified full-length complementary DNAs of mouse genome have been discovered recently. However, function of most the cDNAs remains not elucidated. In the present study, the function of a novel E330021D16 gene, which belongs to the Ube2q subfamily (thus was designated ubiquitin-conjugating enzyme E2 Q2-like, Ube2q2l) and is highly expressed in ovary/oocytes and early embryos, was investigated ectopically in cell lines. When ectopically expressed in mouse pancreatic epithelial cells and P19 embryonal carcinoma cells, Ube2q2l caused cell growth delay/arrest. Multiple morphological abnormalities, such as multinucleated giant cells, long-processes growing- out cells accompanied with enhanced microtubule polymerization, and vacuole formation cells, were observed. Further immunofluorescent staining showed that gamma-H2AX increased dramatically and formed multiple nuclear foci. RT-PCR analysis demonstrated that expression levels of a group of DNA damage/repair related genes, especially the ATM-BRCA2-CHEK2-axis genes, were up-regulated dramatically. Our results suggested that the previously uncharacterized Ube2q2l gene might play an important role in regulating cell cycle progression, DNA damage/repair, and chromosome/chromatin-stability maintenance.
KEYWORDS
Ubiquitin pathway; E2 Ubiquitin-conjugation Enzyme; Cell growth delay/arrest; Multi-nuclei; DNA damage and repair; Gamma-H2AX; p53; Check point

ABBREVIATIONS
AAs, amino acids; DAPI, 4'-6-Diamidino-2-phenylindole; DSBs, DNA double-strand breaks; EGFP, enhanced green fluorescent protein; ES cells, embryonic stem cells; γ-H2AX, gamma-H2AX; GV, germinal vesicle; MII, metaphase II; ORF, open reading frame; PFA, paraformaldehyde ; PHDL cells, pancreatic PNA-HSA double-low cells; RT-PCR, retro transcribed polymerase chain reaction; WT, wild type
INTRODUCTION
A great amount of previously unidentified full-length complementary DNAs that derived from the mouse genome had been reported recently [1,2]. Among the predicted proteincoding genes, a subset genes are involved in the protein ubiquitination pathways [1,2]. Ubiquitin-dependent protein degradation is involved in diverse cellular processes, including cell cycle progression, signal transduction, transcriptional regulation, DNA repair, responses to stress, endocytosis and apoptosis. The most common of ubiquitination is that ubiquitin chain linked by ubiquitin Lys48. The poly ubiquitin chain acted as a signal for protein degradation by 26S proteasome [3-5]. The protein ubiquitination pathway is a tightly programmed enzymes catalyzing process, in which the ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzyme (E2) and ubiquitin-substrate ligases (E3s) functions in sequence. The substrate targeting specificity was mainly determined by E3s. However, each E3 would only interact with some specific E2s, and each E2 would also only interact with some specific E3s. It is well known that different E2s play distinct roles in various biological processes, through regulating ubiquitination and/or deubiquitination [3-8].
In the present study, we identified a previously uncharacterized E330021D16 (Ube2q2l) gene. The predicted Ube2q2l protein contains one RWD and one Ubc domain. It belongs to the ubiquitin conjugation enzyme family [9, 10]. This gene is predominantly detected in ovary and early embryos in mouse. Due to the sample limitation of studying its functions in oocytes and early embryos, we characterized the function of Ube2q2l in mouse pancreatic epithelial cells (PHDL cells) and P19 embryonal carcinoma cells through ectopic overexpression. The results showed that overexpresion of Ube2q2l induced cell cycle delay/arrest, accompanied with multiple morphological abnormalities, such as multinucleated giant cells, long-processes growing-out cells with dramatically enhanced microtubule polymerization, and vacuole formation. Further analysis demonstrated that overexpression of Ube2q2l induced γ-H2AX protein dramatic up-regulation and nuclear foci formation, as well as dramatic up-regulation of a group of DNA damage/repairrelatedgenes. These results suggested that the Ube2q2l is a DNAdamage/repair and chromosome/chromatin-stability related gene, which might play important roles in controlling oocyte-toembryo transition and early embryonic development.
MATERIALS AND METHODS
Cell culture
PHDL pancreatic epithelial cells were derived from fetal pancreas of mice (unpublished data) and cultured under the conditions modified according to the previous report [11]. In brief, the pancreatic PHDL cells were cultured in DMEM basal medium containing 2.5% FBS (Hyclone), 2mM glutamine, 100IU/ml penicillin and 100ug/ml streptomycin. P19 cells were cultured under the conditions described above, in which contained 10% FBS. Colony formation capacity of single cells was analyzed by limited dilution and each single cell well was confirmed by EGFP imaging.
Collection of oocytes and embryos
B6D2F1 (C57BL/6JxDBA2) female mice (8-10 weeks old) were used for collection of GV and MII oocytes. Zygotes were collected from the successfully mated B6D2F1 females. All studies adhered to procedures consistent with the National Institute of Biological Sciences Guide for the care and use of laboratory animals.
Vector construction, lentivirus production and infection
The predicted full-length ORF of Ube2q2l was obtained by RT-PCR from mature ovary. The ORF was cloned into the pWPI vector with SwaI and PacI sites [12], in which the Ube2q2l will be co-expressed with EGFP (not fused). The lentivirus was produced by co-transfection of the pWPI-Ube2q2l vector and two helper vectors, pSPAX2 and pMD2.G.
In vitro transcription and mRNA microinjection
The predicted ORF was cloned into modified pBS-RN3 [13] vector, in which the Ube2q2l was fuse-expressed with Flag and EGFP. Capped RNAs were transcribed with mMessage mMachine (Ambion) under T3 promoter as the protocol provided. In vitro transcribed Ube2q2l mRNA was injected into GV, MII oocytes and zygotes via PIEZO micro-injector as described previously [14].
RT-PCR
Total RNA samples were prepared from GV and MII oocytes,zygotes, 2-, 4- and 8-cell embryos, morula and blastocysts (50 eggs/embryos each), as well as from adult ovary, testis, brain, liver, kidney, ES cells and PHDL cells. The RNA was reverse-transcribed by M-MLV reverse transcriptase (Promega) and amplified by PCR for 30 cycles. Primers were selected encompassing the intronic sequences. PCR cycling was performed at 98°C for 2 min followed by 98°C for 15sec, 54°C to 60°C for 15sec, 72°C for 40sec, and finally 72°C for 8min, by using the PrimeSTAR DNA polymerase (Takara). (See Table 1 to find the primer sequences).
Table 1 The primers had been used and the product size of each gene.

Table 1

The primers had been used and the product size of each gene.

Primers
Genes

Forward: 5' to 3'

Reverse: 5' to 3'

Products size (bp)

Atm

gtcacatcttagcagcccttaa

ctgtaatcagtggattcccttt

451

Brca2

cctgagacttccttaccgagcat

ttcagaggcggactagcaacat

430

Cdk2

ccggctcgacactgagactgaa

gtgaaggacacggtgagaatgg

271

Chek1

catcaggtggtatgtcagagtc

cccttagaaagtcggaagtcaa

502

Chek2

cgtaaataccgagcttattggg

ggctttaagtcccgatgtatga

543

Mdm2

gcaagcacctcacagattccag

gatccttcagatcactcccacc

364

P21

gtgagcagttgcgccgtgattg

tgagggctaaggccgaagatgg

478

P27

taattgggtctcaggcaaactctga

caatgcttttagaggcagatggttt

438

P53

gggacagccaagtctgttatg

ggagtcttccagtgtgatgat

432

Rad9

gcgaatttgcctcttactatcca

cagtgaacgaaacttcttgggtg

393

Rb1

gaaagagcttggctaacttggg

tgagtagtgcaggaggtgagaa

493

Ube2q2l

gagaggctgtgagaggctgt

atgggtaggactcggtgatg

437

b-Actin

accaactgggacgacatggagaaga

ctctttgatgtcacgcacgatttc

414

×
Immunofluorescent staining and confocal microscopy
In brief, cells cultured on cover-slips and pre-implantation embryos were fixed with 4% PFA for 20min. Samples were permeabilized with 0.5% triton X-100 and blocked with 5% normal horse serum for 2h. The first antibodies were incubated overnight at 4°C. First antibodies used in the study are: anti-atubulin (Santa Cruz, USA) and anti-γ-H2AX (Abcam, USA). The Allexa-594 conjugated secondary antibodies were incubated for 1h. Samples were counterstained with 100ng/ml DAPI. Rhodamin-labeled Pholoidin was used for f-actin staining. Images were obtained with an Olympus IX 71 microscope or Zeiss LSM510 Meta confocal microscope.
Western blotting
293T cells were transfected with Ube2q2l-Flag-EGFP,Ube2q2l-N300 (1-300 amino acids of N-terminus)-Flag-EGFP or Flag-EGFP in modified EGFP-N1 vector. Forty-eight hours after transfection, immunoprecipication was performed according to the instructions (FLAGIPT-1; Sigma). Conventional western blotting was performed by using the anti-Flag monoclonal antibody and anti-mouse HRP secondary antibody. Blots were detected by using ECL according to the manufacturer's protocol (Amersham Biosciences).
Figure 1 Amino acids sequence comparison between human UBE2Q2 and predicted mouse Ube2q2l.

Figure 1

Amino acids sequence comparison between human UBE2Q2 and predicted mouse Ube2q2l. The N-terminal RWD domain is shown in red, and the C-terminal Ubc domain is underlined. The most conserved cystines (C304 in human UBE2Q2 and C301 in mouse Ube2q2l) are shown in purple and labeled with one "#" above them. ("*", "." and "blank" represent identical, similar and different amino acids respectively).

×
RESULTS AND DISCUSSION
Bioinformatics analysis and cloning of the predicted mouse Ube2q2l
The mouse E330021D16/Ube2q2l (GeneID: 100502936; NCBI locus: NM_001201390) cDNA has a predicted 1116bp long ORF that encodes 371 amino acids protein (predicted molecular weight 42.23 kDa, isoelectric point 4.50, and charge -19.0). Blastp search showed that it is similar to the recently characterized human UBE2Q2 (GeneID: 92912; NP_001138807). The mouse Ube2q2l gene had been regarded as a pseudogene. We cloned the predicted Ube2q2l ORF from mature oocytes and validated Ube2q2l was a protein coding gene through LC-MS/MS analysis (data not shown). Recently, the NCBI website also changed E330021D16RIK gene from a psudogene to a protein encoding gene. The predicted protein contains one RWD domain and one E2 ubiquitin conjugation enzyme domain (Ubc). The predicted protein has 71% identities and 83% positives with the human UBE2Q2 protein in amino acids sequence (Figure 1). The most important cystine residue in the predicted active site of the Ubc domain was conserved in the predicted protein. We designated it Ube2q2l according to the "Rules for Nomenclature of Genes, Genetic Markers, Alleles, and Mutations in Mouse and Rat" (revised: September, 2011; International Committee on Standardized Genetic Nomenclature for Mice).
Figure 2Expression and subcellular localization of Ube2q2l.

Figure 2

Expression and subcellular localization of Ube2q2l. (A) RT-PCR analysis of the expression pattern of Ube2q2l. It is highly expressed in oocytes, zygotes and early stage embryos (2-cell to 4-cell), and then decrease dramatically and became undetectable. (GV: germinal vesicle oocyte; MII: metaphase II oocyte; Zy: zygote: 2c,4c,8c: 2-cell, 4-cell and 8-cell embryos; Mo: morula; Bl: Blastocyst; Ov: Ovary; Te: testis; ES: embryonic stem cells; PHDL: PNA-HSA double-low pancreatic epithelial cells; Br: brain; Li: liver; Ki: kidney). (B) Conserved domains and constructs design. N-terminal RWD domain and C-terminal Ubc domain are shown. WT1 represents construct design for co-expression but not fused-expression with EGFP. WT2 represents fused-expression with FLAG-EGFP. N300 represents the N-terminus 300 amino acids. (C) Western blot detection of the FLAG-EGFP fused expression of Ube2q2l proteins. WT-Flag-EGFP and N300-Flag-EGFP represent the wild type and C-terminus deleted type, respectively. (Figure D and E) Ube2q2l-EGFP localizes to the cytoplasm in both 2-cell and 4-cell embryos (green: EGFP; Scale bars: 50μm).

×
Expression of mouse Ube2q2l
RT-PCR analysis showed that Ube2q2l was highly expressed in ovary, oocytes, and early embryos. The expression of Ube2q2l gene decreased dramatically and became undetectable from 8-cell stage. It could hardly be detected in ES cells, PHDL pancreatic cells and various organisms including adult brain, liver, and kidney (Figure 2A). Surprisingly, one larger band was observed specifically in adult testis. These results consisted with the EST data on NCBI. Flag-EGFP fused and non-fused expression constructs for in vitro transcription and stable cell line establishment were designed (Figure 2B). Western blot analysis showed that both full-length Ube2q2l and truncated N-terminus Ube2q2l (containing only the N-terminal 300 amino acids coding sequences, N300) could be expressed (Figure 2C). The EGFP fused full length Ube2q2l mRNA and N300 mRNA was microinjected into GV, MII oocytes and zygotes. The results showed that Ube2q2l-EGFP protein was predominantly localized to the cytoplasm of early embryos (Figure 2D, 2E). The protein sequence was confirmed by mass-spectrum analysis (data not shown). However, expression of full-length and N-terminus (N300) proteins did not affect the early embryonic development. The full-length Ube2q2l might not be able to display its roles due to the very high endogenous expression level (mass-spectrum analysis, data not shown). The N-terminus fragment might lose its function to target ubiquitin conjugation complexes and thus cannot play a dominant role due to the requirement the prerequisite conjugation to ubiquitin through UBc domain [15].
Figure 3Ectopic expression of Ube2q2l in PHDL pancreatic epithelial cells induced multiple phenotypes.

Figure 3

Ectopic expression of Ube2q2l in PHDL pancreatic epithelial cells induced multiple phenotypes.(A) Stable EGFP expression in PHDL cells (negative control). One representative single-cell derived colony that containing hundreds of cells on 5th day of culture. The EGFP positive cells grow to form monolayer and maintain the irregular polygon morphology. (B) One representative colony derived from a single Ube2q2l over-expressed cell. Only tens of cells are observed on 8th day of culture. Cells are different in size and morphology. Giant cells with multiple nuclei are be observed (arrows). (C) and (D) Vacuole structures are found in some Ube2q2l over-expressed cells. The vacuole structure localize to the central region of the cells (arrows). (C) and (D) are the same field. (E) to (G) Some typical cells with morphological abnormalities. Enhanced microtubule polymerization is observed in all these cells. (E) Long processes are found in one representative arrested cell (arrow). (F) One arrested multinucleated cell that having long processes (arrow) is shown. (G) One giant cell that containing tens of fragmented nuclei (arrow) is shown. (H) EGFP over-expressed PHDL cells. (green: EGFP; red: a-tubulin; blue: DAPI; Scale bars: (A) to (D), 100μm; (E), 50μm; (F) to (H), 20μm).

×
Over-expression of Ube2q2l in PHDL cells and P19 cells caused cell growth delay/arrest
In order to investigate its functions, we stably overexpressed Ube2q2l ectopically in PHDL cells and P19cell lines by using the lentivirus system. Cell growth delay/arrest was observed in both cell lines. In the EGFP control group, single cells usually grew to form big colonies, in which the polygonal morphology was maintained (Figure 3A). In contrast, most Ube2q2l overexpressed single cells formed colonies containing dramatically less cells (Figure 3B). Quantification analysis showed that the cell growth rate of Ube2q2l over-expressed PHDL cells and P19 cells were slowed down significantly (Figure 4A, B). Cell growth arrest (still one cell, no proliferation) happened in about onetenth (12.7%, 36/283) of the Ube2q2l over-expressed PHDL cells (Figure 4A, B).
Figure 4Statistics analysis of the phenotypes that caused by over-expression of Ube2q2l.

Figure 4

Statistics analysis of the phenotypes that caused by over-expression of Ube2q2l. (A) and (B) Cell number counting in single-cell derived colonies of PHDL cells and P19 cells. (A) When counted on 8th day of cultivation of PHDL cells, 96.1% (272/283) of the Ube2q2l over-expressed colonies have less than 300 cells. However,79.2% (145/183) of the EGFP control colonies have more than 1000 cells. (B) When counted on 3rd day of incubation of P19 cells, 95.3% (123/129) of the Ube2q2l over-expressed colonies have less than 100 cells. However, 85.3% (127/149) of the control colonies have more than 200 cells. (C) to (F) Statistics analysis of cells having abnormal nuclei (multinucleated, giant, and small/fragmented nuclei), having giant cell size, and having vacuolar structures in PHDL cells, respectively. Left panel of each shows the Ube2q2l over-expressed cells, and the right panel of each shows the EGFP control cells. (C) The frequency of the multinucleated cells is 79.3±5.0% in Ube2q2l expressed PHDL cells and is 1.5±1.7% in the control cells. (D) 94.2% (111/118) of the nuclei in control PHDL cells are 12-20μm in length (average: 16.0±2.2%μm). In Ube2q2l over-expressed PHDL cells, 36.6% (41/112) of the cells have 12-20μm of nuclei in length, 25% (28/112) of the cells have nuclei smaller than 12μm, and 38.4% (43/112) of the cells have nuclei larger than 20μm in length. (E) 65.0±6.0% of the Ube2q2l over-expressed PHDL cells are larger than 100μm in length. Only about 1.0% of the cells are larger than 100μm in the EGFP control group. (F) The vacuolar structure containing colonies are 12.9% (36/283) in Ube2q2l over-expressed PHDL cells and only 0.5% (1/186) in control PHDL cells, respectively (Figure 3F).

×
Over-expression of Ube2q2l induced multiple morphological abnormalities
Besides cell cycle delay, most Ube2q2l over-expressed PHDL cells displayed morphological changes. The phenotypes included: (1) Most of the single-cell derived colonies showed heterogeneity in cell size, while some cells became very large (Figure 3B); (2) Many cells grew out long processes with enhanced microtubule polymerization (Figure 3B, E, F), which had never been observed in the untreated PHDL pancreatic epithelial cells; (3) Most of the cells generated multiple nuclei, large nuclei (200. M0 in length, the biggest nucleus found in the PHDL cell is 37.68μm in length), or fragmented nuclei (Figure 3G), compared to control cells with single nucleus (Figure 3A, H); (4) Intriguingly, vacuole structures were found in Ube2q2l over-expressed cells (Figure 3C, D) and they usually localized to the central region of the cells. The subcellular localization highly suggested that the vacuole structures might represent degraded nuclei.
Statistics analysis of the PHDL cells and P19 cells showed that: (1) when counted on 8th day in PHDL cells, 96.1% (272/283) of the Ube2q2l over-expressed single-cell derived colonies contained less than 300 cells, while 79.2% (145/183) of the EGFP over-expressed colonies contained more than 1000 cells (Figure 4A); (2) when counted on 3rd day in P19 cells, 95.3% (123/129) of the Ube2q2l over-expressed colonies contained less than 100 cells, while 85.3% (127/149) of the control colonies had more than 200 cells (Figure 4B); (3) the frequency of the multinucleated cells was 79.3±5.0% in Ube2q2l over-expressed PHDL cells and was 1.5±1.7% in the control cells (Figure 4C); (4) heterogenecity of cell nuclei in Ube2q2l over-expressed PHDL cells (25% (28/112) of the cells with nuclei smaller than 12μm, 38.4% (43/112) of the cells with larger nuclei (longer than 20μm, while only 36.6% (41/112) of the cells had nuclei of 12-20μm in length, that comparable to 94.2% (111/118) of the PHDL cells in control with 12-20μm of nuclei in length (average: 16.0±2.2 μm), (Figure 4D); (5) 65.0% (182/283) of the Ube2q2l over-expressed PHDL cells, compared to only 1.0% of the control cells, were longer than 100μm (Figure 4E); (6) the frequency of the vacuolar structure containing colonies were 12.9% (36/283) in Ube2q2l over-expressed PHDL cells, compared to 0.5% (1/186) in control cells, respectively (Figure 4F). The cell number counting in PHDL cells and P19 cells demonstrated that the cell cycle was delayed severely. The heterogenecity of the phenotypes suggested that mouse Ube2q2l might play multiple and complicated roles in cell cycle control and cytoskeleton regulation.
Figure 5 Over-expression of Ube2q2l induced vacuole does not contain DNA but have increased actin signal. (A to D) and (E to H) show different groups of Ube2q2l over expressing PHDL cells, respectively. Circled cells show that vacuole (arrows) contain relatively higher f-actin signal than non-vacuole regions inside the cells. Scale bars: 50µm for A to D; 20 µm for E to H. (blue: DAPI; red: f-actin; green: Ube2qzl-Flag-EGFP).

Figure 5

Over-expression of Ube2q2l induced vacuole does not contain DNA but have increased actin signal. (A to D) and (E to H) show different groups of Ube2q2l over expressing PHDL cells, respectively. Circled cells show that vacuole (arrows) contain relatively higher f-actin signal than non-vacuole regions inside the cells. Scale bars: 50µm for A to D; 20 µm for E to H. (blue: DAPI; red: f-actin; green: Ube2qzl-Flag-EGFP).

×
Overexpression of Ube2q2l induced vacuole formation and promoted a-tubulin polymerization
F-actin and DAPI double staining in Ube2q2l-EGFP cells showed that there is no DNA component inside the vacuole structure (Figure 5). The actin-intensity was increased but lack of f-actin bundling formation at vacuole formation region. Further analysis showed that the vacuole prefer to locate to the center region of the cell, where the nucleus usually locates (Figure 3B, D). These results suggest that vacuole formation might represent a kind of nucleus depletion or nuclear contents depletion. Furthermore analysis showed that vacuole formation only existed in multinucleated cells but not in cells with single nucleus (Figure 3B, D and Figure 5). This interesting phenomenon suggests that vacuole formation/nucleus depletion might be a compensatory reaction to abnormal high copies of the nuclear materials. Another typical phenomenon observed in Ube2q2l overexpressed PHDL cells is the dramatic change of the a-tubulin. We found that a-tubulin polymerization was dramatically increased in most of the Ube2q2l overexpressed cells, compared to the control cells (Figure 3E to H). The enhanced a-tubulin polymerization plus the nuclear-region vacuole formation with free status f-actin (no f-actin bundling) begin to suppose one of the possible mechanisms might be dysregulated a-tubulin and actin polymerization/depolymerization balance, which further affects cell cycle progression as well as DNA damage/repair and chromatin stability, and finally cause the cell growth delay/arrest, multinucleation, and nuclear/DNA depletion.
Over-expression of Ube2q2l induced DNA damage and activated multiple DNA damage/repair genes
To determine whether overexpression of Ube2q2l could induce DNA damage, we further stained the Ube2q2l overexpressed PHDL cells with the DNA double-strand breaks (DSBs) marker γ-H2AX [16,17]. Weak and homogeneous nuclear γ-H2AX staining was observed in the EGFP over-expressed control cells (Figure 6A). In contrast, hundreds of γ-H2AX nuclear foci were observed in the Ube2q2l over-expressed cells (Figure 6B to F). These data demonstrated that over-expression of Ube2q2l induced DNA damage. RT-PCR analysis was further performed to detect the expression levels of DNA damage/repair related genes, such as Atm, Brca2, Cdk2, Chek1, Chek2, Mdm2, p21, p27, p53, Rad9 and Rb1. The results showed that all the genes detected (except Chek1) were up-regulated obviously in the Ube2q2l over-expressed PHDL cells and P19 cells (Figure 6 G).
Figure 6 Over-expression of Ube2q2l induced DNA damage.

Figure 6

Over-expression of Ube2q2l induced DNA damage. (A) γ-H2AX staining of EGFP over-expressing PHDL cells. The signal is very weak and no nuclear foci are observed. (B) to (F) γ-H2AX staining of Ube2q2l over-expressing PHDL cells. Each circled region represented one multi-nuclei cell in (C). (D) to (F) show typical γ-H2AX foci in Ube2q2l over-expressing PDHL cells. (E) shows one typical multi-nuclei single cell containing several nuclei with similar size. (F) Shows one typical multi-nuclei single cell containing fragmented nuclei with different size. (G) RT-PCR analysis of the expression of DNA damage/repair related genes. All the genes detected (except Chek1) have been up-regulated dramatically in both the PHDL cells (left) and P19 cells (right). "Con" represents control. "O/E" represents Ube2q2l over-expression. Scale bars: 10μm. (green: EGFP; red: γ-H2AX; blue: DAPI).

×
The up-regulation of expression levels of the DNA-damage/repair related genes gave more evidences to the DNA damage. ATM encoded an important cell cycle checkpoint kinase that regulating a wide variety of downstream proteins, including p53, BRCA1, BRCA2, CHK2, checkpoint protein RAD9, and DNA repair protein NBS1 [18-23]. RAD9 is a cell cycle checkpoint protein that required in sensing and repairing DNA damage [24, 25]. MDM2 is a target gene of the p53 and formed an auto regulatory negative feedback loop with p53 [19-21,26]. p53 regulates cyclindependent kinase inhibitor p21 and p27, which plays regulatory roles in S phase DNA replication and DNA damage repair [19,21,23,27]. CHEK1, CHEK2 are cell cycle checkpoint regulators and putative tumor suppressors [18,26-30]. BRCA2 and pRB1 are involved in maintenance of genome stability and double-strand DNA repair [27-31]. The RT-PCR results indicated that overexpression of Ube2q2l activated the pathways that controlling DNA/genome stability and DNA damage repair, especially the ATM-BRCA2-CHEK2 DNA damage-response pathway.
One of the remaining questions is how Ube2q2l caused DNA damage. Most recently, it was reported that, Effete, an E2 ubiquitin-conjugating enzyme could play multiple roles in Drosophila development and chromatin organization [32]. Biochemistry studies will be done to characterize the ubiquitin conjugating activity of Ube2q2l and to find out which ubiquitin pathways it involved in. Another important issue is to find out the function of Ube2q2l in vivo. A great amount of maternal proteins in oocytes would be degraded after fertilization to make it a clean start for embryonic development [33,34]. Knockout mice will be generated to analyze whether Ube2q2l is required during oogenesis, oocyte-to-embryo transition, and early embryonic development. Most recently, it was reported that increased expression of another member of the UBE2Q subfamily, UBE2Q2, was observed in many breast cancers [35]. While another work reported that overexpression of UBE2Q2 would suppress cell proliferation, although ubiquitin-conjugating enzyme UBE2Q2 was highly expressed in many head and neck cancers [36], and suggested that UBE2Q2 might play preventive roles in controlling cell proliferation and carcinogenesis. Further works need to done to explain how Ube2q2l overexpression affects cell cycle progression in details in vitro, which may help us to understand how the endogenous Ube2q2l regulates oocyte-to-embryo transition. Since Ube2q2l is tissue and stage specific expressed in oocytes and early embryos, it is also important to find out how the degradation of Ube2q2l itself is tightly regulated.
CONCLUSIONS
In summary, we found that over-expression of the previously uncharacterized Ube2q2l in PHDL pancreatic epithelial cells and p19 embryonal carcinoma cells caused cell growth delay/arrest, accompanied with multiple morphological abnormalities and DNA damage. Our work indicates that Ube2q2l correlates with cell cycle progression and suggests that it may play important roles in coordinating oocyte-to-embryo transition, in vivo, through regulating protein degradation, and it might also play roles in maintaining genome/chromatin stability during this special developmental period.
ACKNOWLEDGEMENTS
We appreciate Dr. Trono (National Center for Competence in Research, Switzerland) for providing the pWPI lentivirus vectors and Dr. Gurdon for providing the pBS-RN3 vector. We thank the lab members for helpful comments on the manuscript. This project is partially supported by National High Technology Project 863 (2005AA210930).

References
  1. Carninci P, Kasukawa T, Katayama S, Gough J, Frith MC, Maeda N, et al. The transcriptional landscape of the mammalian genome. Science. 2005; 309: 1559-1563.
  2. Okazaki Y, Furuno M, Kasukawa T, Adachi J, Bono H, Kondo S, et al.Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs. Nature. 2002; 420: 563-573.
  3. Hochstrasser M. Protein degradation or regulation: Ub the judge. Cell. 1996; 84: 813-815.
  4. Varshavsky A. The ubiquitin system. Trends Biochem Sci. 1997; 22:383-387.
  5. Hershko A, Ciechanover A. The ubiquitin system. Annu Rev Biochem. 1998; 67: 425-479.
  6. Weissman AM. Themes and variations on ubiquitylation. Nat Rev Mol Cell Biol. 2001; 2: 169-178.
  7. Pickart CM. Back to the future with ubiquitin. Cell. 2004; 116: 181-190.
  8. Wiener R, DiBello AT, Lombardi PM, Guzzo CM, Zhang X, Matunis MJ,et al. E2 ubiquitin-conjugating enzymes regulate the deubiquitinating activity of OTUB1. Nat Struct Mol Biol. 2013; 20: 1033-1039.
  9. Piao Y, Ko NT, Lim MK, Ko MS. Construction of long-transcript enriched cDNA libraries from submicrogram amounts of total RNAs by a universal PCR amplification method. Genome Res. 2001; 11: 1553-1558.
  10. Melner MH, Haas AL, Klein JM, Brash AR, Boeglin WE, Nagdas SK, et al. Demonstration of ubiquitin thiolester formation of UBE2Q2 (UBCi), a novel ubiquitin-conjugating enzyme with implantation site-specific expression. Biol Reprod. 2006; 75: 395-406.
  11. Wang X, Hu J, Zhao D, Wang G, Tan L, Du L, et al. NestinnegCD24low/-population from fetal Nestin-EGFP transgenic mice enriches the pancreatic endocrine progenitor cells. Pancreas. 2005; 31: 385-391.
  12. Naldini L, Blömer U, Gallay P, Ory D, Mulligan R, Gage FH, et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science. 1996; 272: 263-267.
  13. Lemaire P, Garrett N, Gurdon JB. Expression cloning of Siamois, a Xenopus homeobox gene expressed in dorsal-vegetal cells of blastulae and able to induce a complete secondary axis. Cell. 1995; 81: 85-94.
  14. Hu J, Wang F, Zhu X, Yuan Y, Ding M, Gao S, et al. Mouse ZAR1-like (XM_359149) colocalizes with mRNA processing components and its dominant-negative mutant caused two-cell-stage embryonic arrest. Dev Dyn. 2010; 239: 407-424.
  15. Nandi D, Tahiliani P, Kumar A, Chandu D. The ubiquitin-proteasome system. J Biosci. 2006; 31: 137-155.
  16. van Attikum H, Gasser SM. The histone code at DNA breaks: a guide to repair? Nat Rev Mol Cell Biol. 2005; 6: 757-765.
  17. Chowdhury D, Keogh MC, Ishii H, Peterson CL, Buratowski S, Lieberman J. gamma-H2AX dephosphorylation by protein phosphatase 2A facilitates DNA double-strand break repair. Mol Cell. 2005; 20: 801-809.
  18. Hirao A, Kong YY, Matsuoka S, Wakeham A, Ruland J, Yoshida H, et al. DNA damage-induced activation of p53 by the checkpoint kinase Chk2. Science. 2000; 287: 1824-1827.
  19. Riley T, Sontag E, Chen P, Levine A. Transcriptional control of human p53-regulated genes. Nat Rev Mol Cell Biol. 2008; 9: 402-412.
  20. Marine JC, Francoz S, Maetens M, Wahl G, Toledo F, Lozano G, et al.Keeping p53 in check: essential and synergistic functions of Mdm2 and Mdm4. Cell Death Differ. 2006; 13: 927-934.
  21. Toledo F, Wahl GM. Regulating the p53 pathway: in vitro hypotheses, in vivo veritas. Nat Rev Cancer. 2006; 6: 909-923.
  22. Chen L, Gilkes DM, Pan Y, Lane WS, Chen J. ATM and Chk2-dependent phosphorylation of MDMX contribute to p53 activation after DNA damage. EMBO J. 2005; 24: 3411-3422.
  23. Xu Y, Yang EM, Brugarolas J, Jacks T, Baltimore D. Involvement of p53 and p21 in cellular defects and tumorigenesis in Atm-/- mice. Mol Cell Biol. 1998; 18: 4385-4390.
  24. Hopkins KM, Auerbach W, Wang XY, Hande MP, Hang H, Wolgemuth DJ, et al. Deletion of mouse rad9 causes abnormal cellular responses to DNA damage, genomic instability, and embryonic lethality. Mol Cell Biol. 2004; 24: 7235-7248.
  25. Pandita RK, Sharma GG, Laszlo A, Hopkins KM, Davey S, Chakhparonian M, et al. Mammalian Rad9 plays a role in telomere stability, S- and G2-phase-specific cell survival, and homologous recombinational repair. Mol Cell Biol. 2006; 26: 1850-1864.
  26. Itahana K, Mao H, Jin A, Itahana Y, Clegg HV, Lindström MS, et al.Targeted inactivation of Mdm2 RING finger E3 ubiquitin ligase activity in the mouse reveals mechanistic insights into p53 regulation. Cancer Cell. 2007; 12: 355-366.
  27. Garner E, Raj K. Protective mechanisms of p53-p21-pRb proteins against DNA damage-induced cell death. Cell Cycle. 2008; 7: 277-282.
  28. Bartek J, Lukas J. DNA damage checkpoints: from initiation to recovery or adaptation. Curr Opin Cell Biol. 2007; 19: 238-245.
  29. Harrison JC, Haber JE. Surviving the breakup: the DNA damage checkpoint. Annu Rev Genet. 2006; 40: 209-235.
  30. Löbrich M, Jeggo PA. The impact of a negligent G2/M checkpoint on genomic instability and cancer induction. Nat Rev Cancer. 2007; 7:861-869.
  31. Wang W. Emergence of a DNA-damage response network consisting of Fanconi anaemia and BRCA proteins. Nat Rev Genet. 2007; 8: 735-748.
  32. Cipressa F, Cenci G. Effete, an E2 ubiquitin-conjugating enzyme with multiple roles in Drosophila development and chromatin organization. Fly (Austin). 2013; 7.
  33. Yi YJ, Nagyova E, Manandhar G, Procházka R, Sutovsky M, Park CS, et al. Proteolytic activity of the 26S proteasome is required for the meiotic resumption, germinal vesicle breakdown, and cumulus expansion of porcine cumulus-oocyte complexes matured in vitro. Biol Reprod. 2008; 78: 115-126.
  34. DeRenzo C, Seydoux G. A clean start: degradation of maternal proteins at the oocyte-to-embryo transition. Trends Cell Biol. 2004; 14: 420-426.
  35. Nikseresht M, Seghatoleslam A, Monabati A, Talei A, Ghalati FB, Owji AA. Overexpression of the novel human gene, UBE2Q2, in breast cancer. Cancer Genet Cytogenet. 2010; 197: 101-106.
  36. Maeda H, Miyajima N, Kano S, Tsukiyama T, Okumura F, Fukuda S, et al. Ubiquitin-conjugating enzyme UBE2Q2 suppresses cell proliferation and is down-regulated in recurrent head and neck cancer. Mol Cancer Res. 2009; 7: 1553-1562.

Cite this article: Hu J, Wang Y, Gao S (2013) Over expression of Novel Ubiquitin - Conjugating Enzyme Ube2q2l (E330021D16) Causes Cell Growth Delay/Arrest through Inducing DNA Damage. JSM Biochem Mol Biol 1(1): 1004.
Current Issue Vol.1.1
Footer
Content:   Home  |  Aims & Scope  |  Early Online  |  Current Issue  | 
Journal Info:   Editorial Board  |  Article Processing Charges  |  FAQs
Contact Us
2952 Market Street, Suite 140
San Diego, California 92102, USA
Tel: 1-619-373-8030
Fax: 1-619-793-4845
Toll free number: 1-800-762-9856
Copyright © 2013 JSciMed Central. All rights reserved.