Tobacco and the polymorphism of survivin gene at its promoter region are the risk factors of Oral cancer. Our aim of this study is to find the association between tobacco and survivin -31C/G polymorphism in Oral cancer. It is a case-control study with 47 cases of OSCC and 100 controls. We used polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) protocols on blood samples of patients. A statistically significant relationship between naswar and GC genotype (P value= 0.03). The GG and GC genotype also showed similar association with gutka (P value=0.0003 and 0.0031) and betel quid (P value=0.018 and 0.0041) respectively. However our study did not find any statistically significant association of Survivin genotypes with Areca nut and smoking. Our study found a positive association between Survivin -31 genotypes and Naswar, Gutka and betel quid, however smoking and areca nut didn’t show any statistically significant association with either of Survivin variants. The synergistic combination between different varieties of tobacco and survivin -31 polymorphism can aid in the development and progression of oral cancer.

• Tobacco
• Survivin variants
• Polymorphism
• Oral Cancer

Mehdi RF, Qamar N, Ferrozuddin N, Zafar S, Irfan Z (2024) Association of Tobacco with Survivin -31 Variants in Oral Cancer. Ann Otolaryngol Rhinol 11(4): 1343.

Cancer stands as the primary cause of mortality across developed and developing nations, yet its prevalence and types vary geographically due to distinct risk factors. Oral Squamous Cell Carcinoma (OSCC) prevails in India, Pakistan, Bangladesh and Sri Lanka, predominantly affecting the buccal mucosa, tongue, and lips [1]. The habitual risk factors like smoking, betel quid, gutka and alcohol are the most common risk factors in the development of oral squamous cell carcinoma [2]. Genetic elements like single nucleotide polymorphisms (SNPs) interact with environmental factors, elevating cancer susceptibility. Thus the two work synergistically in the development of OSCC [3].

The use of tobacco in the form of chewable products or smoking causes obvious changes in the mucosa that aids in the cancer development. Arecoline found in betel quid is the predominant alkaloid and the most potent carcinogen, it alters the expression of several genes involved in histone methylation, acetylation and demethylation [4]. The carcinogens present in tobacco smoke include polycyclic aromatic hydrocarbons, N-nitrosamines, aromatic amines, aldehydes. Inhalation and metabolic activation of these carcinogens during exposure to tobacco smoke often causes changes in DNA sequences and development of point mutations [5]. Catechu which consist of tannin and polyphenols is the main culprit in gutka and is highly mutagenic. Trismus is another issue faced by gutka users which further makes difficult to diagnose oral cancer at an earlier stage [6-8].

Survivin, indeed, is a fascinating protein with multifaceted roles in cancer development and progression. Its involvement in inhibiting apoptosis, promoting cell replication, and interfering with key caspases underscores its significance in cancer biology. The fact that survivin is expressed in various malignancies like lung, gastric, endometrial, head and neck, and hepatocellular cancers highlights its broad impact across different types of cancer [9]. The polymorphism -31 in the promoter region of the survivin gene, is significant in the context of cancer development and progression [10].

Understanding the intricate interplay between genetic factors like survivin and environmental influences provides valuable insights into the mechanisms underlying cancer development. Targeting proteins like survivin holds promise for developing personalized therapeutic strategies aimed at disrupting cancer progression. This study aims to illuminate the interplay between genetic factors, tobacco usage, and oral cancer pathogenesis.

There were 47 oral cancer samples and 100 controls included in this study. The oral cancer (cases) comprised of 38(81%) males and 9(19%) females with mean age of 49. The Urdu speaking ethnic group was the most common ethnic group in cases 64% and controls 43%. The major cancer sites included buccal mucosa (83%) and tongue (13%). Gutka was one of the most consumed type of tobacco (55%) followed by betel quid (30%) and naswar (15%). Areca nut and smoking both were consumed by 11%. The GG genotype was present in 18 cases and 57 controls. The GC genotype was present in 24 cases and 42 controls while the CC variant was present in 4 cases and 1 control (Table 1).

Table 1: Showing the demographic data along with frequency of survivin variants, stages and grades of oral cancer.

We further analyzed the association of different varieties of tobacco with OSCC, we found a positive association of naswar (p value 0.001), gutka (p value 0.00), betel quid (p value 0.00) and Areca nut (p value 0.003) with OSCC. Smoking on the other hand did not show any statistically significant relationship with OSCC (p value 0.17) (Table 2).

Table 2: Shows the association of different types of tobacco with cases and controls.

The association between the different types of tobacco and the genotypes were also investigated. We found a positive association between naswar and GC genotype (OR=10.2, 95%CI=1.12-93.6, P value0.03). The GG genotype and the GC genotype also showed a statistically significant association with Gutka (OR=225, 95% CI=11.8-425, p value 0.0003) and (OR=78.7, 95%CI=4.36-141,p value 0.0031) respectively. The GC genotype also showed a positive association with betel quid (OR=23, 95%CI=2.69-197, p value=0.0041). Areca nut and smoking did not show a statistically significant association with any of the genotypes. The details of association with every variety of tobacco and the genotype is given in the Table 3.

Table 3: Shows the association of different varieties of tobacco with Survivin -31 variants in Cases and Controls

This case control study was conducted at a tertiary care hospital in Karachi. A total of 147 blood samples were taken. Out of 147 samples, 47 samples were of already diagnosed oral squamous cell carcinoma patients while 100 samples were of controls. Consecutive method of sampling was used. The inclusion criteria of patients was 18 years and above individuals already diagnosed with OSCC. Controls included 18 years and above individuals with no prior history of cancer. The consent of patients and controls were taken and patients with a family history of any cancer were excluded from the study. A detailed history was recorded with the help of self-designed questionnaire. 3cc blood was collected in EDTA tube from controls as well as cases. It was then centrifuged at 4000 rpm for 10 mins and then stored at 4 degrees. DNA was extracted using Gene JET Genomic DNA purification kit of Thermo scientific according to manufacturer’s protocol. Extracted DNA was stored at -20oC. The primers used were;

Forward 5’GCCATTAACCGCCAGATTT 3’

Reverse 5’GAAGGGCCAGTTCTTGAATGTA 3’

Thermo Scientific MspI (HpaII) restriction enzyme was used for enzyme digestion. The digested products yielded an uncut fragment of GG, 26 and 112 bp for CC and 138, 26, 112bp of CG genotype. They were visualized on 2% agarose gel.

Statistical analysis

SPSS version 20 was used for data entry. Quantitative data was presented as mean and standard deviation. And for Qualitative data frequencies and percentages were calculated. Association between survivin -31 variants and tobacco use in oral cancer patients was seen through application of chi square. Odds ratio (OR) was calculated by logistic regression at 95% CI and P-value less than 0.05 was considered significant.

Tobacco has been associated with the risk of developing Oral Cancer since ages, however it is also one of the most important risk factor of premature death globally [11]. The polymorphism in survivin gene promoter area is also identified as one of the risk factor of many cancers including oral cancer [12,13]. So in this study we investigated the association between different varieties of tobacco and survivin -31 promoter polymorphism in OSCC patients.

In this study, the maximum number of patients belonged to middle age group. The mean age of cases was calculated to be 49, this was in line with a study conducted by Alamgir et al. [14], which showed similar age group being affected. This can be attributed to the addictive use of tobacco from an early age as a habit. A systemic review declared results in contrast where maximum number of patients were of the age of 60 years or above with Human Papilloma Virus being the primary cause [15].

Male predominance was seen in our study (38; 81%) in accordance with other studies signifying that males are more prone to develop OSCC as compared to females [16,17]. However a study done in Karachi 2016 showed that females are more prone to develop OSCC from oral submucosal fibrosis [18]. This could be because of indulgence into habits like addictive use of tobacco especially in males.

The most prominent ethnic group, accounting for 30% of cases, was Urdu speaking, followed by Sindhis at 15%. The two major sites of OSCC presentation were the buccal mucosa (83%) and tongue (13%). Akram et al., also reported similar findings, noting the alveolar mucosa as another common site for OSCC [17,18]. This pattern is often associated with the habit of keeping chewable tobacco products in the buccal sulcus for sustained release of nicotinic products, providing pleasure. Interestingly, this habit is predominantly observed in the Urdu speaking ethnic group.

There was a positive association between different varieties of tobacco and OSCC. Gutka, naswar, betel quid, Areca nut showed statistically significant p value (<0.005) with OSCC. Analysis of studies across the globe revealed that the carcinogenic ingredients present in all varieties of tobacco products erode the squamous cells of oral cavity paving way for opportunistic organisms like HPV to invade the basal epithelium and develop OSCC. They also cause fibrosis and ulcers which due to continuous use of tobacco do not heal and results in formation of cancer [8,19-21].

The association between different types of tobacco (chewable and smoked) and survivin variants was evaluated in this study. We found a statistically significant relationship between naswar and GC genotype. The GG and GC genotype also showed similar association with gutka and betel quid. However our study did not find any statistically significant association with Areca nut and smoking. This finding was in contrast with a study done in Taiwan, which showed their positive association between the CC genotype and smoking [22]. This could be because of our limited sample size. A number of studies show significant link between the environmental/habitual factors and the genetic factors in carcinogenesis. A synergistic effect is created when the two that is the environmental and genetic factors are present which accounts for the development and progression of cancer [23- 25]. The polymorphism of survivin transcriptively activates the formation of protein which inhibits apoptosis and pave a way for the formation of tumor while the habitual use of tobacco further damages the tumor cells by its carcinogenic potential [26,27]. Our study highlighted the positive association of different varieties of tobacco used around the world with Survivin variants in oral cancer patients thereby signifying the complex interplay between the environmental factor and genetic factors in developing multifactorial diseases like cancer.

The association between tobacco exposure and survivin variants can indeed predict oral cancer prognosis and guide personalized therapy. Additionally, genetic alterations in oral cancer patients with a history of tobacco use suggests the need for categorizing patients based on genetic signature and type of tobacco used for precise treatment strategies, highlighting the importance of personalized medicine [28]. By considering survivin levels, genetic variants, and tobacco exposure, clinicians can tailor treatment approaches for better outcomes in oral cancer patients.

Interaction among the survivin variants and tobacco can significantly increase the risk for Oral cancer. Personalized therapeutic strategies aimed for targeting survivin promoter polymorphism together with cessation of tobacco use can lead towards better prognosis of oral cancer.

1. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: a cancer journal for clinicians. 2021; 71: 209-49.
2. Dhanuthai K, Rojanawatsirivej S, Thosaporn W, Kintarak S, Subarnbhesaj A, Darling M, et al. Oral cancer: A multicenter study. Med Oral Patol Oral Cir Bucal. 2018; 23: e23.
3. Ali J, Sabiha B, Jan HU, Haider SA, Khan AA, Ali SS. Genetic etiology of oral cancer. Oral Oncology. 2017; 70: 23-8.
4. Wang T-H, Hsia S-M, Shih Y-H, Shieh T-M. Association of Smoking, alcohol use, and betel quid chewing with epigenetic aberrations in cancers. Int J Mol Sci. 2017; 18: 1210.
5. Prabhakaran PA, Nair SS. The influence of dietary & habitual agents in oral carcinogenesis: Short review. 2018.
6. Niaz K, Maqbool F, Khan F, Bahadar H, Hassan FI, Abdollahi M. Smokeless tobacco (paan and gutkha) consumption, prevalence, and contribution to oral cancer. Epidemiol Health. 2017; 39.
7. Sankhla B, Kachhwaha K, Hussain SY, Saxena S, Krishana-Sireesha S, Bhargava A. Genotoxic and Carcinogenic Effect of Gutkha: A Fast- growing Smokeless Tobacco. Addict Health. 2018; 10: 52-63.
8. Baig S, Rubab Z, Farooq W. Molecular Pathogenesis of Chewable Tobacco. J Coll Physicians Surg Pak. 2018; 28: 381-5.
9. Santarelli A, Mascitti M, Lo Russo L, Sartini D, Troiano G, Emanuelli M, et al. Survivin-based treatment strategies for squamous cell carcinoma. Int J Mol Sci. 2018; 19: 971.
10. Rafatmanesh A, Behjati M, Mobasseri N, Sarvizadeh M, Mazoochi T, Karimian M. The survivin molecule as a double-edged sword in cellular physiologic and pathologic conditions and its role as a potential biomarker and therapeutic target in cancer. J Cell Physiol. 2020; 235: 725-744.
11. Jiang X, Wu J, Wang J, Huang R. Tobacco and oral squamous cell carcinoma: A review of carcinogenic pathways. Tob Induc Dis. 2019; 17: 29.
12. Mehdi RF, Sheikh F, Khan R, Fawad B, Haq AU. Survivin Promoter Polymorphism (-31 C/G): A Genetic Risk Factor for Oral Cancer. Asian Pac J Cancer Pre. 2019; 20: 1289-1293.
13. Rasool I, Wani KA, Yousuf A, Bhat IA, Rah B, Nazir SU, et al. Role of the functional polymorphism of survivin gene (-31G/C) and risk of breast cancer in a North Indian population. Clin Breast Cancer. 2018; 18: e671-e676.
14. Alamgir MM, Jamal Q, Mirza T. Conventional clinical and prognostic variables in 150 oral squamous cell carcinoma cases from the indigenous population of Karachi. Pak J Med Sci. 2016; 32: 672-676.
15. Gormley M, Creaney G, Schache A, Ingarfield K, Conway DIJBDJ. Reviewing the epidemiology of head and neck cancer: definitions, trends and risk factors. Br Dent J. 2022; 233: 780-786.
16. Khammissa R, Meer S, Lemmer J, Feller L. Oral squamous cell carcinoma in a South African sample: Race/ethnicity, age, gender, and degree of histopathological differentiation. J Cancer Res Ther. 2014; 10: 908-914.
17. Khan A, Khan S, Khitab U. Emerging clinical and histopathological spectrum of oral squamous cell carcinoma. Cell. 2015; 300: 5721773.
18. Mohiuddin S, Fatima N, Hosein S, Hosein M. High risk of malignant transformation of oral submucous fibrosis in Pakistani females: A potential national disaster. J Pak Med Assoc. 2016; 66: 1362-1366.
19. Baig S, Rubab Z, Arif MM, Lucky M. Chewable risk factors-Threatened oral cancer HPV’s Looming Epidemic in Pakistan. European Journal of Biotechnology and Bioscience. 2015; 3: 39-45.
20. Gandini S, Botteri E, Iodice S, Boniol M, Lowenfels AB, Maisonneuve P, et al. Tobacco smoking and cancer: a meta-analysis. Int J Cancer. 2008; 122: 155-164.
21. Johnson N. Tobacco use and oral cancer: a global perspective. J Dent Educ. 2001; 65: 328-339.
22. Weng C, Hsieh Y, Chen M, Tsai C, Lin C, Yang S. Survivin SNP- carcinogen interactions in oral cancer. J Dent Res. 2012; 91: 358-363.
23. Chen YJ, Chang JTC, Liao CT, Wang HM, Yen TC, Chiu CC, et al. Head and neck cancer in the betel quid chewing area: recent advances in molecular carcinogenesis. Cancer Sci. 2008; 99: 1507-1514.
24. Kotnis A, Sarin R, Mulherkar R. Genotype, phenotype and cancer: role of low penetrance genes and environment in tumour susceptibility. J Biosci. 2005; 30: 93-102.
25. Irimie AI, Ciocan C, Gulei D, Mehterov N, Atanasov AG, Dudea D, et al. Current insights into oral cancer epigenetics. Int J Mol Sci. 2018; 19: 670.
26. Shojaei F, Yazdani-Nafchi F, Banitalebi-Dehkordi M, Chehelgerdi M, Khorramian-Ghahfarokhi M. Trace of survivin in cancer. Eur J Cancer Prev. 2019; 28: 365-372.
27. Boffetta P, Hecht S, Gray N, Gupta P, Straif K. Smokeless tobacco and cancer. Lancet Oncol. 2008; 9: 667-675.
28. Yesupatham ST, Dayanand C, Azeem Mohiyuddin S, Harendra Kumar MJC. An insight into Survivin in relevance to hematological, biochemical and genetic characteristics in tobacco chewers with oral squamous cell carcinoma. Cells. 2023; 12: 1444.