Loading

The Impact of Ethanol on Increasing HIV-1 Replications in U1 Cells

Research Article | Open Access | Volume 5 | Issue 1

  • 1. Division of Emerging and Transfusion Transmitted Diseases, Lab of Molecular Virology, Center for Biologics Evaluation and Research, Food and Drug Administration. USA
+ Show More - Show Less
Corresponding Authors
Xue Wang, Laboratory of Molecular Virology; Division of Emerging and Transfusion Transmitted Diseases; CBER/FDA, Building 72, New Hampshire Avenue, Silver Spring; Tel: 240-402-8237; Fax: 301-595-1233
Abstract

Alcohol consumption leads to injury in various tissues/organs, and impairs immune functions. The effects of alcohol consumption on HIV-1 infection and acceleration of disease progression remain controversial. It is also not well-known if alcohol abuse leads to reactivation of HIV-1 replication from latency and causes virologic failure. Using susceptible U1 cells chronically infected with HIV-1, we examined the effects of alcohol on latency in macrophages. We found that low levels (0.05~0.2 g/ml) of ethanol treatments increased HIV-1 replication with upregulating expression of AP-1 and NFAT and activation of NF?Bp65 through inducing TCR-related pathways, P-TEFb pathway and MAPK-signaling pathways, regulating expression of epigenetic factors with enhanced expression of histone acetylation, inhibition of HDAC and controlling histone methylation. Ethanol treatments increased p47phox expression and decreased cell viabilities in a dose-dependent manner with inducing both apoptotic pathways and autophagy pathways. High levels (0.4 g/ml) of ethanol treatment caused significantly lower cell viability with no detectable changes in reactivation of HIV-1 replication through inhibited expression/activation of CD3, CD28, PKCθ and ZAP-70 in TCR-related pathways. These results indicate that low levels of ethanol enhance HIV-1 replication without significant loss of cells while ethanol at high levels reduces cell counts with no detectable changes of HIV-1 replication.

Citation

Wang X, Zhao J, Ragupathy V, Hewlett I (2018) The Impact of Ethanol on Increasing HIV-1 Replications in U1 Cells. Clin Res HIV/AIDS 5(1): 1048.

Keywords

• HIV; Ethanol; Macrophage; Latency; Transcription factors

INTRODUCTION

HIV-1/AIDS remains a major problem despite recent advances in antiretroviral therapy (ART). However, HIV-1 infection remains incurable because of latent infection, leading to some infected cells persisting as a latent reservoir, and the virus persists in latently infected cells or viral reservoirs which can be reactivated upon discontinuation of cART [1]. One of the factors that has been associated with increased risk of the acquisition of HIV-1 infection and accelerated disease progression is the use of alcohol or drugs of abuse [2].

Blood alcohol concentration is usually expressed as a percentage of ethanol in the blood in units of mass of alcohol per volume of blood or mass of alcohol per mass of blood in North America. From US Federal Aviation Regulation (CFR) 91. 17, person with 0.001~0.029g in one ml of blood (0.001~0.029 g/ ml) appears normal, 0.03~0.059 g/ml shows mild euphoria. 0.08 g/ml or higher is considered legally impaired, and a range of 0.35 g/ml to 0.40 g/ml usually represents potentially fatal alcohol poisoning. It has been estimated that over 50% of the general population are at least occasional users of alcohol and estimates of the proportion of the general population who are heavy drinkers are as high as 8% [2]. Alcohol consumption leads to injury in various tissues and organs including liver, pancreas, heart, brain and muscle, and impairs immune functions [3].

The use of alcohol has been reported to be associated with increased risk of the acquisition of HIV-1 infection and accelerated disease progression as measured primarily by decreased CD4+ cell counts in patients receiving ART [4]. Despite antiretroviral therapy, HIV positive individuals experienced increased mortality and physiologic injury at lower levels of alcohol use compared with uninfected individuals [5], suggesting that patients with HIV infection who ingest alcohol are at greater risk for alcohol associated adverse events and toxicities and underscores the need for simultaneous treatment of alcohol use disorders and HIV in patients with co-occurring conditions [5].

The most studied strategy in HIV-1 infection is the so called “shock and kill” therapy [6]. This strategy is based on reactivation of dormant viruses from the latently-infected reservoirs (the shock) followed by the eradication of the reservoirs (the kill). Several drugs have been developed to target some of cellular factors involved in HIV-1 latency, called Latency Reversing Agents (LRAs), which include: i) can activate host transcription factors that are required for HIV-1 transcript, such as NF-B, NFAT, and AP1 through activation of TCR-related signaling pathways and PKC signaling pathway; ii) are able to activate P-TEFb (positive transcription elongation factor b) signaling pathway involved in HIV-1 Tat molecule, and iii) can control epigenetic factors to open the nucleosomes to facilitate HIV transcription [7]. However, it is not well known if alcohol abuse plays any roles in reactivation of HIV-1 replication from its latent infection.

Macrophages contribute to HIV-1 pathogenesis by forming a viral reservoir that serve as a viral source for the infection of CD4 T cells. Cells of the monocyte/macrophage lineage are one of the major cellular targets of HIV-1 and are relatively resistant to the cytopathic effect of HIV as these cells can survive infection with HIV for extended periods of time [8]. A recent study using a humanized mouse model shows that HIV-1 can persist in macrophages during antiretroviral therapy, suggesting that macrophages may represent an obstacle to efforts to cure HIV1 infection [9]. Here, using HIV-1-infected cell line, U1 cells, a subclone of U937 chronically infected with HIV-1, which can be used as an in vitro model for HIV-1 latent study [8], treated with ethanol, we found that ethanol treatments could reactivate HIV-1 replication from its latent infection in macrophages with inducing cell activation, and apoptotic/autophagy signaling pathways.

MATERIALS AND METHODS

Chemicals and Reagents

Antibodies against Atg4D, AP-1, Bax, Bechlin-1, Brd4, CD4, CD28, CDK9, ERK1/2, FADD, Grb2, HDAC1, HDAC2, HEXIM1, IL2, JNK, Lat, MBD2, NFAT, NF-kB p65, Nod-1, p38, p47phox, PCAF, PKCθ, PLCγ-1, PARP-1, RAS, TCRβ, and ZAP-70 were purchased from Santa Cruz Biotechnology ]Santa Cruz, CA). Acetyl-H3, Caspase-3, Caspase-8, Cyclin T1, H3K4, H3K27, phosphor-FADD, IFI16, LC3, mTor, phosphor-NF-kB p65, phospho-p38, p-Rpb-CTD, Ulk1, phosphor-ZAP-70 and GAPDH were bought from Cell Signaling Technology, Inc (Danvers, MA). Pure ethyl alcohol (≥99.99% ) and all other chemicals were from Sigma (St. Louis, MO).

Cell Culture And Treatment with Ethanol

U1 (promonocytic) cells, a subclone of U937 chronically infected with HIV-1, were obtained from the National Institutes of Health AIDS Research Reference and Reagent Program (Germantown, MD) and cultured at 37 ° C in 5% CO2 in RPMI 1640 medium containing 10% fetal calf serum, 2 mM glutamine, 50 μg/ml penicillin, and 50 μg/ml streptomycin. For ethanol (EtOH) treatments, U1 cells were seeded at 2 × 105 cells/ml and cultured in the medium containing 0, 0.05, 0.1, 0.2, or 0.4 g per ml of medium (weight (g)/volume (ml, g/ml) for 3 days.

Real-time PCR

Quantitative real-time reverse-transcriptase (RT) PCR was used for quantitation of viral RNA. Viral RNA was isolated from 140 µl of culture supernatant by using the QIAamp Viral RNA Mini Kit (Valencia, CA 91355) according to the manufacturer’s protocol. The primers and TaqMan probe were designed in the gag capsid (p24) region, which is the variable region among most of the HIV1 subtype B isolate sequences according to GenBank database. The forward primer was 5`-GACATCAAGCAGCCATGCAA-3`, corresponding to nucleotides 1367-1386, and the reverse primer was 5`- CTATCCCATTCTGCAGCTTCCT -3`, corresponding to nucleotides 1430-1409. The TaqMan probe was oligonucleotide 5`-ATTGATGGT CTCTTTTAACA-3`, corresponding to nucleotides 1488-1507, coupled with a reporter dye [6-carboxy fluorescein] (FAM) at the 5` end and a non-fluorescent quencher and a minor groove binder [MGB], which is a Tm enhancer, at the 3` end. The nucleic acids were amplified and detected in an automated TaqMan 7500 Analyzer by using QuantiTectTM Probe RT-PCR kit (Qiagen Inc., Valencia, CA). The 25-µl PCR mixture consisted of 100 nM primers and 100 nM probe. Following three thermal steps at 55 °C for 5 min, at 50 °C for 30 min and at 95 °C for 10 min, 45 cycles of two-step PCR at 95 °C for 15 s and at 60 °C for 1 min were performed.

The data are expressed as copy numbers/ml. Known concentrations of HIV-1 (MN) viral RNA (serially diluted: 108 to 100 copies) were used as templates and quantitative RT-PCR performed to generate a standard curve. Each value represents the average concentration of six reactions in triple isolated repeats based on the standard curve.

Western blot analysis 

Proteins were isolated from U1 cells with RIPA buffer (1×PBS, 1% (v/v) NP-40, 0.5% (w/v) sodium deoxycholate, 0.1% (w/v) SDS, 0.1 mg/ml PMSF, 30 μl/ml aprotinin, 1 mM sodium orthovanadate). Equal amounts of protein were boiled in the loading buffer (100 mM Tris–HCl, 200 mM DTT, 4% SDS, 0.2% bromphenol blue, 20% glycerol), separated on SDS-PAGE and blotted onto polyvinylidene difluoride membranes. The data represented are from three independent experiments. The relative quantitation of protein expression was determined with Image J (Image Processing and Analysis in Java) from NIH website (https://imagej.nih.gov/ij/).

Cell viability assay

Cell viability was determined by Trypan blue exclusion analysis (Life Technologies).

Statistical analysis

The unpaired Student’s t test was used for data analyses as indicated, and a value of p < 0.05 [*]was considered significant, p < 0.01 [**] very significant.

RESULTS

Ethanol Treatment Increased the Activation of HIV-1 replication

Alcohol abuse is an important public health problem, frequently unrecognized among people living with HIV/AIDS [2]. It has been reported that alcohol abuse in people with HIV/ AIDS is positively associated with a lower CD4 cell count [4], although it is controversial if alcohol abuse has relationship with higher HIV-1 viral load values. To investigate if ethanol treatment can increase HIV-1 replication in macrophages, U1 cells were cultured in medium containing different concentration of ethanol for 3 days; the supernatants from cell culture were used as RT-PCR and proteins from cell pellets were subjected to Western blotting analysis. As shown in Fig. 1A, ethanol treatment significantly increased HIV-1 replication in a dose of 0.05~0.2g/ ml, lower concentration of ethanol showed increased HIV-1 RNA production and treatments of 0.4 g/ml of ethanol had no effect on HIV-1 replication in U1 cells, suggesting that ethanol is able to reactivate HIV-1 replication from its latent state at certain levels of ethanol treatment.

It is well known that the HIV-1 LTR has been shown to contain recognition sequences for many cellular transcription factors, including AP1, NFAT, and NF-?B, which play very important roles in HIV-1 replication [10]. In order to examine whether ethanol treatments in increased activation of HIV-1 replication affect these host transcription factors, proteins from the cell pellets were subjected to Western blotting to detect Ap1, NFAT, total NF?B p65, and phosphorylation of NF-?B p65. As shown in Fig. 1B, ethanol treatment dramatically upregulated expression of Ap-1, NFAT and phosphorylation of NF-?B p65.

These data indicate that ethanol can activate HIV-1 replication from HIV-1 latent infection via increasing expression of some host transcription factors.

Ethanol treatment could activate T-cell receptor (TCR)/CD3-related signaling pathways

Latent HIV proviruses are thought to be primarily reactivated in vivo through stimulation of the T-cell receptor (TCR)/CD3 [11]. TCR/CD3 activation induces multiple signal transduction pathways leading to the ordered nuclear migration of the HIV transcription initiation factors NF-κB and NFAT as well as potential effects on HIV transcriptional elongation [11]. As shown in Fig. 2, U1 cells treated with lower concentration [0.05~0.20 g/ml] of ethanol displayed increased expression of TCRβ, and 0.05~0.1 g/ml of ethanol upregulated CD3 expression, suggesting that ethanol can increase/activate the TCR/CD3 complex, which is required for HIV-1 replication.

CD28 is one of the proteins expressed on T cells that provide co-stimulatory signals required for T cell activation and survival [12]. Ethanol treatments with lower concentrations (0.05~0.10 g/ml) were able to increase expression of protein CD28 [Fig. 2A].

The transmembrane adapter LAT (linker for activation of T cells) plays a central role in signaling by ITAM bearing receptors and leads to the phosphorylation of tyrosine residues present in the intracellular domain of LAT and formation of a multiprotein complex with other adapter molecules and enzymes including Grb2 and PLCγ isoforms [13], which is recognized to play a central role in linking TCR-mediated activation, such as ZAP-70 and PKC?, at the membrane to the stimulation of the vast majority of downstream events [13]. U1 cells treated with lower concentration (0.05~0.20 g/ml) of ethanol displayed increased expression of LAT, 0.05~0.1 g/ml of ethanol up regulated the expression of Grb2 [Fig. B], PLCγ-1 and PKCθ, activated ZAP-70 by its phosphorylation [Fig. 2C].

High level (0.4 g/ml) of ethanol did not increase HIV-1 production [Fig. 1A], which might be because 0.4 g/ml of ethanol treatment down regulated of expression of CD3, CD28 [Fig. 2A], PLCγ-1 and PKCθ [Fig. 2C], and inhibited activation of ZAP-70 [Fig. 2C].

These results indicate that the important role of T cell activation pathways and others triggered by TCR stimulation is to activate NFAT and NF-κB through TCR-related pathways. Ethanol may increase T cell activation through TCR/CD3 signaling pathways, leading to activation of NFAT and NF-κB pathways, and increased HIV-1 replication within a certain level of ethanol treatments.

Ethanol treatment could activate signaling pathways of positive transcription elongation factor b (P-TEFb) and MAPK signaling pathways

The positive transcription elongation factor, P-TEFb, a cellular kinase composed of Cyclin T1 and CDK9, is a cyclin dependent kinase that can phosphorylate the DRB (5,6-dichloro-1-β-dribofuranosylbenzimidazole) sensitivity inducing factor (DSIF) and negative elongation factor (NELF), which is essential for processive HIV-1 transcription [14]. P-TEFb complex is expressed at low levels in resting cells. P-TEFb can be activated by HIV-1 protein Tat. RNA polymerase II pauses after transcription of TAR in the absence of Tat. Tat recruits P-TEFb via CycT1 to TAR, allowing CDK9 to phosphorylate the C-terminal domain (CTD) of RNAP polymerase II. As shown in Fig. 3A, ethanol could increase CDK9 expression, and 0.05~0.1 g/ml of ethanol treatments showed increased expression of Cyclin T1, and CTD, suggesting that ethanol can increase/activate P-TEFb signaling pathway in HIV-1-infected macrophages.

It has been reported that protein HEXIM1 or 2 associated with a noncoding RNA, 7SK, to bind to P-TEFb can inactivate the elongation of transcription by RNA polymerase II [14]. 0.05~0.2 g/ml of ethanol treatment inhibited the expression of HEXIM1 [Fig. 3B]. These data indicate that ethanol can activate P-TEFb signaling pathway to increase HIV-1 transcription.

Previously, we reported that MAPKs (mitogen-activated protein kinase), extracellular signal-regulated kinases (ERK) ½, p38, and c-jun-N-terminal kinases ½ (JNK), were upregulated in HIV-1 primary infection [15]. ERK1/2 and JNK were reported to reactivate HIV-1 replication from its latent infection through AP-1 and NF-?B, and p38 can reactivate replication from HIV-1 latency via C/EBPβ-mediated induction of HIV-1 gene expression in U1 cells [8]. Here, we found that U1 cells treated with ethanol displayed increased expression of ERK1/2, p38, phosphorylation of p38, and U1 cells treated with 0.05~0.1 g/ml of ethanol increased JNK expression [Fig. 3C], suggesting that ethanol treatments can activate MAPK signaling pathways.

https://www.jscimedcentral.com/public/assets/images/uploads/image-1767352995-1.JPG

Figure 3 Ethanol treatment could activate signaling pathways of positive transcription elongation factor b (P-TEFb) and MAPK signaling pathways. U1 cells were cultured in medium containing 0, 0.05, 0.1, 0.2, and 0.4 g/ml of ethanol for 3 days. Proteins isolated from the cell pallets with RIPA buffer were subjected to Western blot analysis to detect to (A) Brd 4, CDK9, Cyclin T1, and CTD; (B) HEMIM1; and (C) ERK1/2, phosphorylation of p38, p38 and JNK.

Ethanol treatment could affect expression of epigenetic factors

In resting CD4+ T cells, chromatin structure at the site of provirus integration plays critical role in repressing provirus transcription. Sequence-specific transcription factors can recruit histone deacetylases (HDACs) and other chromatin-modifying enzymes to the provirus promoter, resulting in transcriptional repression and virus latency; while chromatin acetylation by histone acetyltransferases (HATs) promotes chromatin opening and is associated with active euchromatin [16]. U1 cells treated with 0.05 g/ml of ethanol showed a decreased expression of HDAC1 while HDAC2 had no changes [Fig. 4A]. Further, ethanol could upregulated Acetyl-Histone H3 protein expression [Fig. 4A].

https://www.jscimedcentral.com/public/assets/images/uploads/image-1767353030-1.JPG

Figure 4 Ethanol treatment could affect expression of epigenetic factors. U1 cells were cultured in medium containing 0, 0.05, 0.1, 0.2, and 0.4 g/ml of ethanol for 3 days. Proteins isolated from the cell pallets with RIPA buffer were subjected to Western blot analysis to detect (A) HDAC1, HDAC2 and Acetyl-H3; (B) MBD2; (C) H3K4 and H3K27; and (D) PCAF.

Methyl-CpG binding domain protein 2 (MBD2), which binds methylated HIV DNA, was identified as a regulator of HIV-1 latency. Ethanol treatments downregulated MBD2 expression in U1 cells [Fig. 4B].

Histone methylation can be either linked to transcriptional repression or activation, depending on the site of modification. Methylation of H3 at lysine residue 4(H3K4) is associated with transcriptional activation while methylation of H3K27 is associated with transcriptional repression [16]. 0.05~0.2 g/ml of ethanol upregulated H3K4 expression and 0.05~0.1 g/ml of ethanol down regulated H3K27 expression in U1 cells [Fig. 4C].

The HIV protein, Tat, stimulates transcription from the viral long-terminal repeats [LTR] through an RNA hairpin element, transactivation responsive region (TAR) [17]. It has been reported that Tat-associated histone acetyltransferases (TAHs), p300 and p300/CBP-associating factor (PCAF), assists functionally in the activation of chromosomally integrated HIV-1 LTR [16]. Ethanoltreated U1 cells displayed increased expression of PCAF [Fig. 4D].

These data indicate that ethanol treatment can change the structure of nucleosome by modulating proteins, HDAC, DNA methylation and histone acetylation, which open nucleosomes to facilitate HIV transcription.

Ethanol treatment could activate both apoptotic and autophagy signaling pathways

It was reported that alcohol activated T cells that normally underwent apoptosis [18]. To test if ethanol inhibits cell growth and induce apoptosis and autophagy, U1 cells were treated with different concentration of ethanol for 3 days. High levels (0.4 g/ ml) of ethanol very significantly inhibited the growth of U1 cells relative to control (0 g/ml of ethanol) [Fig. 5A].

Apoptosis is a process of programmed cell death that occurs in multicellular organisms, which arebiochemical events leading to characteristic cell changes (morphology) and death. We found that ethanol treatment could activate both external and internal apoptotic pathways in U1 cells with increased expression of protein FADD and Bax, and activation of FADD, caspase-8 and caspase-3 [Fig. 5B].

https://www.jscimedcentral.com/public/assets/images/uploads/image-1767353062-1.JPG

Figure 5 Ethanol treatment could activate both apoptotic and autophagy signaling pathways. U1 cells were cultured in medium containing 0, 0.05, 0.1, 0.2, and 0.4 g/ml of ethanol for 3 days. (A) Cell viability (% of survival of cells treated with ethanol vs. non-treatment) was determined by Trypan blue exclusion analysis. Proteins isolated from the cell pallets with RIPA buffer were subjected to Western blot analysis to detect (B) phosphorylation of FADD, FADD, Caspase-8, Bax and Caspase-3; (C) mTor, Ulk1, p62/SQSTM1, Atg4D, LC3 and Beclin-1; (D) RAS, p47phox, and IFI16.

Autophagy is a genetically programmed, evolutionarily conserved intracellular degradation pathway involved in the trafficking of long-lived proteins and cellular organelles to the lysosome for degradation to maintain cellular homeostasis. Emerging evidence suggests that autophagy is involved in alcohol-induced tissue injury [3]. Autophagy pathways were activated by ethanol treatments in U1 cells with inhibition of mTOR expression and increased the expression of p62/SQSTM1, Atg4D, Ulk1, LC3 and Beclin-1 [Fig. 5C], suggesting that ethanol treatments may activate autophagy pathways.

One mechanism contributing to ethanol-induced apoptosis in T cells could involve downregulation of a signaling molecule called renin angiotensin (RAS) [19]. Lowered RAS levels in turn induce dysregulation of mitochondria and enhance production of reactive oxygen species (ROS) that can damage various molecules in the cells [19]. Ethanol treatment could decrease RAS expression in U1 cells [Fig. 5D]. ROS acts as primary or secondary messengers to promote cell growth or death [15]. p47phox is one of the oxidase activators required for NADPH oxidase to produce ROS [15,19]. As shown in Fig. 5D, p47phox protein levels were increased during ethanol treatments in U1 cells.

The DNA sensors interferon-inducible protein 16 (IFI16) has been reported to be increased in treatment-naive patients, and IFI16 expression is correlated with high viral load and low CD4 cell count [20]. Ethanol treatment increased IFI16 expression in U1 cells [Fig.5D].

These results indicate that ethanol can produce ROS and induce cell death through apoptotic and autophagy pathways with an increased reactivation of HIV-1 replication.

Ethanol treatments could upregulate expression of PARP-1, IL-2 and Nod-1.

Poly (ADP-ribose) polymerase 1 (PARP-1) is an abundant nuclear enzyme that catalyzes the successive transfer of the ADP-ribose moiety of NAD+ to a variety of nuclear proteins, including itself [21]. PARP-1 is required for the activation of NF-κB-dependent target genes, including HIV-1 LTR in reporter constructs; PARP-1 may also play a role in HIV-1 integration [21].

https://www.jscimedcentral.com/public/assets/images/uploads/image-1767353095-1.JPG

Figure 6 Ethanol treatments could upregulate expression of PARP-1, IL-2 and Nod-1. U1 cells were cultured in medium containing 0, 0.05, 0.1, 0.2, and 0.4 g/ml of ethanol for 3 days. Proteins isolated from the cell pallets with RIPA buffer were subjected to Western blot analysis to detect (A) PARP-1; (B) IL-2; (C) Nod-1.

Ethanol treatment increased PARP-1 expression [Fig. 6A].

IL-2, an autocrine T-cell growth factor, is produced predominantly by CD4+ T cells. IL-2 stimulates the proliferation of CD4+ and CD8+ T cells and NK cells, and enhances cytolytic activity against a variety of target cells. It has been demonstrated that the intermittent administration of rIL-2 with cART results in substantial and significantly higher CD4+ T-cell increases than those achieved with either dual nucleoside reverse transcriptase inhibitor therapy or more potent cART alone [22]. Ethanol treatment significantly enhanced IL-12 expression [Fig. 6B], suggesting that ethanol can activate monocyte cells.

During HIV-1 infection macrophages can be activated, and NOD-1 (nucleotide oligomerization domain-1) can synergize IL32 that stimulates IL-1β and IL-6 release [23]. U1 cells treated with ethanol displayed increased Nod-1 expression [Fig. 6C].

DISCUSSION

The direct effect of alcohol of immune toxicity induces T-cell apoptosis and diminishes important functionality of natural killer cells and macrophages [18]. HIV-infected individuals have higher prevalence of alcohol use disorders than do uninfected individuals [24]. The studies with rhesus macaques have showed that chronic alcohol intake prior to and during HIV/SIV infection results in a higher viral set point, more rapid progression to end-stage disease, and AIDS wasting [25]. Alcohol consumption is associated with lower CD4 counts [4]. A cohort study in US Military was demonstrated to be a statistically significant relationship between virologic failure and at-risk drinking [26]. However, the mechanism in which alcohol leads to virologic failure is unknown.

Several mechanisms to silence HIV gene expression and replication in HIV-1 latency have been reported, such as mutations in viral genome, blocking accession of RNA polymerase into nucleosome, inactivation/absence of transcription factors, and problems with RNA processing and transportation [7]. Since 1987, it has been clear that activation of infected cells is required for HIV to replicate, which follows the translocation of transcription factors, such as NF-?B, into the nucleus [10, 11]. Lower levels of alcohol can activate U1 cells and increase the expression of some host transcription factors [Fig.1 & 2].

https://www.jscimedcentral.com/public/assets/images/uploads/image-1767352832-1.JPG

Figure 1 Ethanol treatment increased the activation of HIV-1 replication. U1 cells were cultured in medium containing 0, 0.05, 0.1, 0.2, and 0.4 g/ml of ethanol for 3 days. (A) 140 µl of culture supernatants containing HIV-1 particles were used to isolate viral RNA. 10 µl in 50 µl of the RNA was used as template to perform real-time PCR. Known concentrations of HIV-1 (MN) viral RNA (serially diluted: 108 to 100 copies) were used as templates and quantitative RT-PCR performed to generate a standard curve. Each value represents the average concentration of six reactions in triple isolated repeats based on the standard curve. The value of p < 0.05 (*) was considered significant, p < 0.01 (**) very significant. (B) The cell pellets were lysed with RIPA buffer and the lysates were subjected to Western blot analysis to detect to AP-1, NFAT, the phosphorylation of NF-?B p65 and total NF-?B p65.

https://www.jscimedcentral.com/public/assets/images/uploads/image-1767352886-1.JPG

Figure 2 Ethanol treatment could activate T-cell receptor (TCR)/CD3-related signaling pathways. U1 cells were cultured in medium containing 0, 0.05, 0.1, 0.2, and 0.4 g/ml of ethanol for 3 days. Proteins isolated from the cell pallets with RIPA buffer were subjected to Western blot analysis to detect to (A) TCRβ, CD3 and CD28; (B) LAT and Grb2; and (C) PLCγ-1, phosphorylation of ZAP-70, ZAP-70 and PKCθ.

Studies show that chronic alcohol abuse in humans and animal models result in reduced numbers of peripheral T cells, lymphopenia, which can increase homeostatic proliferation, and increase T cell differentiation and activation [18]. Chronic alcohol consumption can induce apoptosis with caspase-3 activation and exposure to different concentration of ethanol causes decreased cell viability in a dose-dependent manner [27] [Fig. 5A]. Furthermore, ethanol exposure promoted expression of the pro-apoptotic proteins, such as Bax and FADD, suggesting that ethanol treatments can sensitize T cells [28] and U1 cells [Fig. 5] to activation-induced cell death (AICD) [28]. Previously, we reported that pro-apoptotic proteins could activate the activation of T cell line, Jurkat cells and PBMC, and increase HIV1 replication, while anti-apoptotic molecules could inhibit HIV-1 replication [29-31]. Here we found that ethanol treatment could activate U1 cells with inducing of TCR-related signaling pathways [Fig. 2], and inhibit cell viabilities by inducing both apoptotic signaling pathways [Fig. 5] and production of ROS leading to cellular damage.

Cumulative evidence has shown that virus replication is enhanced when host cells initiate the apoptotic program. This phenomenon is called an Alternative Replication Program (ARP), a process when the host cell is undergoing apoptosis during viral infection. Viruses adopt an emergency escape mechanism to produce a large amount of virus rapidly [32]. Expression/ activation of some preapoptotic molecules from apoptotic pathways, such as Bax, FADD, caspase-3, and caspase-8 are sufficient to initiate the ARP in HIV-1 infection [29-31] and influenza A virus infection [33]. Treatment with cytotoxic drugs has been reported to produce and activate HIV-1 replication in pro-monocytic (U1) and lymphoid (ACH-2) cell lines persistently infected with HIV-1 [32]. However, further study is needed to determine if ethanol-induced apoptosis causes activation of U1 cells, or ethanol treatments lead to activation-induced cell death (AICD). These changes in turn compromise the cells’ ability to respond to pathogens and contribute to increased susceptibility to infections, which may contribute to alcohol abuse increases in acquisition of HIV-1 infection and leads to virologic failure.

Autophagy is a dynamic multistep process that is tightly regulated by many signaling pathways involving nutrients, energy, and stress response [3]. mTORC1 is a negative regulator at the pre-initiation complex to regulate the initiation of autophagosome biogenesis [3]. It has been reported that HIV-1 infection induces autophagy in monocytes/macrophages and that knockdown of Beclin-1 decreases HIV-1 replication [34, 35]. However, it remains controversial whether HIV-1 infection induces or represses autophagy. Early in 2008, it was reported that in vitro HIV-1 infection could repress autophagy in T cells [36], but the conclusion resulted from the cell cultured under serum starvation. Previously we found that, in normal cell culture condition, HIV infections significantly increase transcription of ULK1, a member of the autophagy-initiated complex. Two ubiqutin-like conjugation systems, the Atg12 conjugation system and the microtubule-associated protein L chain 3 (LC3) conjugation system that control the elongation of the autophore to form the autophagosome [37]. We found here that ethanol could induce autophagy signaling pathways in HIV1-infected microphage [Fig. 5C]. Further investigation is needed to determine what the functions of ethanol-induced autophagy are in HIV-1 replication and cell viability.

In humans, a direct effect of alcohol consumption has been more difficult to establish, and the effects of at-risk drinking on HIV infection remain controversial. Different studies on alcohol consumption in HIV-1 positive individuals reached different conclusions compared to HIV-1 negative drinkers, including: i) increased HIV-1 replication with no alterations in CD28-CD57+, naïve or memory T-cell phenotypes associated with immunosenescence [38]; ii) lower CD4 counts, but not progression to AIDS [39]; iii) lower CD4 counts with accelerated disease progression [4,40], and iv] decrease response to ART and virologic failure [28,41]. Besides differences in race, life styles and environment, lower level of alcohol consumption may be one of the reasons that there is an increase in HIV-1 replication with no significantly decreased cell counts, while high level of alcohol

drinking may significantly lower cell counts leading to HIV-1 replication with undetectable changes. Therefore, decreased HIV-1 replication may not progress fast enough to AIDS.

In conclusion, the monocytic U1 cell line, which shows minimal constitutive expression of HIV-1, when treated with different concentrations of ethanol, displayed increases in HIV1 replication at 0.05~0.2 g/ml of ethanol and no undetectable changes at high level (0.4 g/ml) of ethanol. The ethanol-induced HIV-1 replication was related to upregulation/activation of host transcription factors, AP-1, NFAT and NF-?Bp65 through increased expression/activation of TCR, CD3, CD28, PLCγ-1, ZAP-70 and PKCθ in TCR-related pathways, Brd4, CDK9, Cyclin T1 and CTD in P-TEFb pathway, and ERK1/2, p38 and JNK in MAPK signaling pathways. Ethanol treatment could modulate expression of epigenetic factors to easily open the nucleosomes to facilitate HIV transcription.

ACKNOWLEDGEMENTS

The authors wish to acknowledge of Dr. Krishnakumar Devadas and Dr. Mohan Setty for critical review of this manuscript. We further acknowledge the NIH AIDS reagent repository for the reagents. This work was supported by an internal CBER modernize science grant and OBRR critical path grant. The findings and conclusions in this article have not been formally disseminated by the Food and Drug Administration and should not be construed to represent any Agency determination or policy.

Author Contributions

X.W. and I.H. conceived and designed the experiments; X.W., J.Z., and V.R. performed the experiments; and X.W. analyzed the data, and X.W. and I.H. wrote the paper. All authors have read and approved the final manuscript.

REFERENCES

1. Boritz EA, Douek DC. Perspectives on Human Immunodeficiency Virus (HIV) Cure: HIV Persistence in Tissue. J Infect Dis. 2017; 215:128-133.

2. Krupitsky EM, Horton NJ, Williams EC, Lioznov D, Kuznetsova M, Zvartau E, Samet JH. Alcohol use and HIV risk behaviors among HIVinfected hospitalized patients in St. Petersburg, Russia. Drug Alcohol Depend. 2005; 79: 251–256.

3. Li Y, Wang S, Ni HM, Huang H, Ding WX Autophagy in alcohol-induced multiorgan injury: mechanisms and potential therapeutic targets. Biomed Res Int. 2014; 2014: 1-20.

4. Wu ES, Metzger DS, Lynch KG, Douglas SD. Association between alcohol use and HIV viral load. J Acquir Immune Defic Syndr. 2011; 56: 129–130.

5. Justice AC, McGinnis KA, Tate JP, Braithwaite RS, Bryant KJ, Cook RL, et al. Risk of mortality and physiologic injury evident with lower alcohol exposure among HIV infected compared with uninfected men. Drug Alcohol Depend. 2016; 161: 95-103.

6. Darcis G, Van Driessche B, Van Lint C. HIV Latency: Should We Shock or Lock? Trends Immunol. 2017; 38: 217-228.

7. Cary DC, Fujinaga K, Peterlin BM. Molecular mechanisms of HIV latency. J Clin Invest. 2016; 126: 448-454.

8. Wang X, Sun B, Mbondji C, Biswas S, Zhao J, Hewlett I. Differences in Activation of HIV-1 Replication by Superinfection With HIV-1 and HIV-2 in U1 Cells. J Cell Physiol. 2017; 232:1746-1753.

9. Honeycutt JB, Wahl A, Baker C, Spagnuolo RA, Foster J, Zakharova O, et al. Macrophages sustain HIV replication in vivo independently of T cells. J Clin Invest. 2016; 126: 1353-1366.

10. Mousseau G, Valente ST. Role of Host Factors on the Regulation of Tat-Mediated HIV-1 Transcription. Curr Pharm Des. 2017; 23: 4079-4090.

11. Somech R. T-cell receptor excision circles in primary immunodeficiencies and other T-cell immune disorders. Curr Opin Allergy Clin Immunol. 2011; 11: 517-524.

12. Parish ST, Wu JE, Effros RB. Sustained CD28 expression delays multiple features of replicative senescence in human CD8 T lymphocytes. J Clin Immunol. 2010; 30: 798-805.

13. Wang JK, Kiyokawa E, Verdin E, Trono D. The Nef protein of HIV-1 associates with rafts and primes T cells for activation. Proc Natl Acad Sci USA 2000; 97: 394–399.

14. Zaborowska J, Isa NF, Murphy S. P-TEFb goes viral. Bioessays. 2016; 38: 75-85.

15. Wang X, Viswanath R, Zhao J, Tang S, Hewlett I. Changes in the level of apoptosis-related proteins in Jurkat cells infected with HIV-1 versus HIV-2. Mol Cell Biochem. 2010; 337: 175-183.

16. Turner AW, Margolis DM. Chromatin Regulation and the Histone Code in HIV Latency. Yale J Biol Med. 2017; 90: 229-243.

17. Hu P, Wang X, Zhang B, Zhang S, Wang Q, Wang Z. Fluorescence polarization for the evaluation of small-molecule inhibitors of PCAF?BRD/Tat-AcK50 association. Chem Med Chem. 2014; 9: 928- 931.

18. Pasala S, Barr T, Messaoudi I. Impact of Alcohol Abuse on the Adaptive Immune System. Alcohol Res. 2015; 37: 185-197.

19. Rehman S, Chandel N, Salhan D, Rai P, Sharma B, Singh T, Husain M, Malhotra A, Singhal PC. Ethanol and vitamin D receptor in T cell apoptosis. J Neuroimmune Pharmacol. 2013; 8: 251-261.

20. Pyndiah N, Telenti A, Rausell A. Evolutionary genomics and HIV restriction factors. Curr Opin HIV AIDS. 2015; 10: 79-83.

21. Bueno MT, Reyes D, Valdes L, Saheba A, Urias E, Mendoza C, Fregoso OI, Llano M. Poly(ADP-ribose) polymerase 1 promotes transcriptional repression of integrated retroviruses. J Virol. 2013; 87: 2496-2507.

22. Pett SL, Kelleher AD, Emery S. Role of interleukin-2 in patients with HIV infection. Drugs. 2010; 70: 1115-1130.

23. Hernandez JC, Giraldo DM, Paul S, Urcuqui-Inchima S. Involvement of neutrophil hyporesponse and the role of Toll-like receptors in human immunodeficiency virus 1 protection. PLoS One. 2015; 10: 0119844.

24. Freiberg MS, McGinnis KA, Kraemer K, Samet JH, Conigliaro J, Curtis Ellison R, et al. The association between alcohol consumption and prevalent cardiovascular diseases among HIV-infected and HIV-uninfected men. J Acquir Immune Defic Syndr. 2010; 53: 247-253.

25. Marcondes MC, Watry D, Zandonatti M, Flynn C, Taffe MA, Fox H. Chronic alcohol consumption generates a vulnerable immune environment during early SIV infection in rhesus macaques. Alcohol Clin Exp Res. 2008; 32: 1583-1592.

26. Deiss RG, Mesner O, Agan BK, Ganesan A, Okulicz JF, Bavaro M, Lalani T, O’Bryan TA, Bebu I, Macalino GE. Characterizing the Association Between Alcohol and HIV Virologic Failure in a Military Cohort on Antiretroviral Therapy. Alcohol Clin Exp Res. 2016; 40: 529-535.

27. Hote PT, Sahoo R, Jani TS, Ghare SS, Chen T, Joshi-Barve S, et al. Ethanol inhibits methionine adenosyltransferase II activity and S-adenosylmethionine biosynthesis and enhances caspase-3- dependent cell death in T lymphocytes: relevance to alcohol-induced immunosuppression. J Nutr Biochem. 2008; 19: 384-391.

28. Kapasi AA, Patel G, Goenka A, Nahar N, Modi N, Bhaskaran M, Reddy K, Franki N, Patel J, Singhal PC. Ethanol promotes T cell apoptosis through the mitochondrial pathway. Immunology. 2003; 108: 313- 320.

29. Wang X, Ragupathy V, Zhao J, Hewlett I. Molecules from apoptotic pathways modulate HIV-1 replication in Jurkat cells. Biochem Biophys Res Commun. 2011; 414: 20-24.

30. Tan J, Wang X, Devadas K, Zhao J, Zhang P, Hewlett I. Some mechanisms of FLIP expression in inhibition of HIV-1 replication in Jurkat cells, CD4+ T cells and PBMCs. J Cell Physiol. 2013; 228: 2305-2313.

31. Wang X, Tan J, Zhao J, Ragupathy V, Haleyurgirisetty M, Hewlett I. Some findings of FADD knockdown in inhibition of HIV-1 replication in Jurkat cells and PBMCs. l Cell Biochem. 2014; 393: 181-190.

32. Khan SZ, Hand N, Zeichner SL. Apoptosis-induced activation of HIV-1 in latently infected cell lines. Retrovirology. 2015; 12: 42-61.

33. Wang X, Tan J, Zoueva O, Zhao J, Ye Z, Hewlett I. Novel pandemic influenza A [H1N1] virus infection modulates apoptotic pathways that impact its replication in A549 cells. Microbes Infect. 2014; 16: 178- 186.

34. Rodriguez M, Lapierre J, Ojha CR, Estrada-Bueno H, Dever SM, Gewirtz DA. Importance of Autophagy in Mediating Human Immunodeficiency Virus [HIV] and Morphine-Induced Metabolic Dysfunction and Inflammation in Human Astrocytes. Viruses. 2017; 9: 201. doi: 10.3390/v9080201.

35. Cao L, Glazyrin A, Kumar S, Kumar A. Role of Autophagy in HIV Pathogenesis and Drug Abuse. Mol Neurobiol. 2017; 54: 5855-5867.

36. Zhou D, Spector SA. Human immunodeficiency virus type-1 infection inhibits autophagy. AIDS. 2008; 22: 695-699.

37. Wang X, Gao Y, Tan J, Devadas K, Ragupathy V, Takeda K, Zhao J, Hewlett I. HIV-1 and HIV-2 infections induce autophagy in Jurkat and CD4+ T cells. Cell Signal. 2012; 24: 1414-1419.

38. So-Armah KA, Edelman EJ, Cheng DM, Doyle MF, Patts GJ, Gnatienko N, et al. Effects of Heavy Drinking on T-Cell Phenotypes Consistent with Immunosenescence in Untreated HIV Infection. Alcohol Clin Exp Res. 2016; 40: 1737-1743.

39. Hahn JA, Samet JH. Alcohol and HIV disease progression: weighing the evidence. Curr HIV/AIDS Rep. 2010; 7: 226-233.

40. Samet JH, Cheng DM, Libman H, Nunes DP, Alperen JK, Saitz R Alcohol consumption and HIV disease progression. J Acquir Immune Defic Syndr. 2007; 46: 1994-1999.

41. Hendershot CS, Stoner SA, Pantalone DW, Simoni JM Alcohol use and antiretroviral adherence: review and meta-analysis. J Acquir Immune Defic Syndr. 2009; 52: 180-202.

Wang X, Zhao J, Ragupathy V, Hewlett I (2018) The Impact of Ethanol on Increasing HIV-1 Replications in U1 Cells. Clin Res HIV/AIDS 5(1): 1048.

Received : 22 Oct 2018
Accepted : 20 Nov 2018
Published : 23 Nov 2018
Journals
Annals of Otolaryngology and Rhinology
ISSN : 2379-948X
Launched : 2014
JSM Schizophrenia
Launched : 2016
Journal of Nausea
Launched : 2020
JSM Internal Medicine
Launched : 2016
JSM Hepatitis
Launched : 2016
JSM Oro Facial Surgeries
ISSN : 2578-3211
Launched : 2016
Journal of Human Nutrition and Food Science
ISSN : 2333-6706
Launched : 2013
JSM Regenerative Medicine and Bioengineering
ISSN : 2379-0490
Launched : 2013
JSM Spine
ISSN : 2578-3181
Launched : 2016
Archives of Palliative Care
ISSN : 2573-1165
Launched : 2016
JSM Nutritional Disorders
ISSN : 2578-3203
Launched : 2017
Annals of Neurodegenerative Disorders
ISSN : 2476-2032
Launched : 2016
Journal of Fever
ISSN : 2641-7782
Launched : 2017
JSM Bone Marrow Research
ISSN : 2578-3351
Launched : 2016
JSM Mathematics and Statistics
ISSN : 2578-3173
Launched : 2014
Journal of Autoimmunity and Research
ISSN : 2573-1173
Launched : 2014
JSM Arthritis
ISSN : 2475-9155
Launched : 2016
JSM Head and Neck Cancer-Cases and Reviews
ISSN : 2573-1610
Launched : 2016
JSM General Surgery Cases and Images
ISSN : 2573-1564
Launched : 2016
JSM Anatomy and Physiology
ISSN : 2573-1262
Launched : 2016
JSM Dental Surgery
ISSN : 2573-1548
Launched : 2016
Annals of Emergency Surgery
ISSN : 2573-1017
Launched : 2016
Annals of Mens Health and Wellness
ISSN : 2641-7707
Launched : 2017
Journal of Preventive Medicine and Health Care
ISSN : 2576-0084
Launched : 2018
Journal of Chronic Diseases and Management
ISSN : 2573-1300
Launched : 2016
Annals of Vaccines and Immunization
ISSN : 2378-9379
Launched : 2014
JSM Heart Surgery Cases and Images
ISSN : 2578-3157
Launched : 2016
Annals of Reproductive Medicine and Treatment
ISSN : 2573-1092
Launched : 2016
JSM Brain Science
ISSN : 2573-1289
Launched : 2016
JSM Biomarkers
ISSN : 2578-3815
Launched : 2014
JSM Biology
ISSN : 2475-9392
Launched : 2016
Archives of Stem Cell and Research
ISSN : 2578-3580
Launched : 2014
Annals of Clinical and Medical Microbiology
ISSN : 2578-3629
Launched : 2014
JSM Pediatric Surgery
ISSN : 2578-3149
Launched : 2017
Journal of Memory Disorder and Rehabilitation
ISSN : 2578-319X
Launched : 2016
JSM Tropical Medicine and Research
ISSN : 2578-3165
Launched : 2016
JSM Head and Face Medicine
ISSN : 2578-3793
Launched : 2016
JSM Cardiothoracic Surgery
ISSN : 2573-1297
Launched : 2016
JSM Bone and Joint Diseases
ISSN : 2578-3351
Launched : 2017
JSM Bioavailability and Bioequivalence
ISSN : 2641-7812
Launched : 2017
JSM Atherosclerosis
ISSN : 2573-1270
Launched : 2016
Journal of Genitourinary Disorders
ISSN : 2641-7790
Launched : 2017
Journal of Fractures and Sprains
ISSN : 2578-3831
Launched : 2016
Journal of Autism and Epilepsy
ISSN : 2641-7774
Launched : 2016
Annals of Marine Biology and Research
ISSN : 2573-105X
Launched : 2014
JSM Health Education & Primary Health Care
ISSN : 2578-3777
Launched : 2016
JSM Communication Disorders
ISSN : 2578-3807
Launched : 2016
Annals of Musculoskeletal Disorders
ISSN : 2578-3599
Launched : 2016
Annals of Virology and Research
ISSN : 2573-1122
Launched : 2014
JSM Renal Medicine
ISSN : 2573-1637
Launched : 2016
Journal of Muscle Health
ISSN : 2578-3823
Launched : 2016
JSM Genetics and Genomics
ISSN : 2334-1823
Launched : 2013
JSM Anxiety and Depression
ISSN : 2475-9139
Launched : 2016
Clinical Journal of Heart Diseases
ISSN : 2641-7766
Launched : 2016
Annals of Medicinal Chemistry and Research
ISSN : 2378-9336
Launched : 2014
JSM Pain and Management
ISSN : 2578-3378
Launched : 2016
JSM Women's Health
ISSN : 2578-3696
Launched : 2016
Clinical Research in HIV or AIDS
ISSN : 2374-0094
Launched : 2013
Journal of Endocrinology, Diabetes and Obesity
ISSN : 2333-6692
Launched : 2013
Journal of Substance Abuse and Alcoholism
ISSN : 2373-9363
Launched : 2013
JSM Neurosurgery and Spine
ISSN : 2373-9479
Launched : 2013
Journal of Liver and Clinical Research
ISSN : 2379-0830
Launched : 2014
Journal of Drug Design and Research
ISSN : 2379-089X
Launched : 2014
JSM Clinical Oncology and Research
ISSN : 2373-938X
Launched : 2013
JSM Bioinformatics, Genomics and Proteomics
ISSN : 2576-1102
Launched : 2014
JSM Chemistry
ISSN : 2334-1831
Launched : 2013
Journal of Trauma and Care
ISSN : 2573-1246
Launched : 2014
JSM Surgical Oncology and Research
ISSN : 2578-3688
Launched : 2016
Annals of Food Processing and Preservation
ISSN : 2573-1033
Launched : 2016
Journal of Radiology and Radiation Therapy
ISSN : 2333-7095
Launched : 2013
JSM Physical Medicine and Rehabilitation
ISSN : 2578-3572
Launched : 2016
Annals of Clinical Pathology
ISSN : 2373-9282
Launched : 2013
Annals of Cardiovascular Diseases
ISSN : 2641-7731
Launched : 2016
Journal of Behavior
ISSN : 2576-0076
Launched : 2016
Annals of Clinical and Experimental Metabolism
ISSN : 2572-2492
Launched : 2016
Clinical Research in Infectious Diseases
ISSN : 2379-0636
Launched : 2013
JSM Microbiology
ISSN : 2333-6455
Launched : 2013
Journal of Urology and Research
ISSN : 2379-951X
Launched : 2014
Journal of Family Medicine and Community Health
ISSN : 2379-0547
Launched : 2013
Annals of Pregnancy and Care
ISSN : 2578-336X
Launched : 2017
JSM Cell and Developmental Biology
ISSN : 2379-061X
Launched : 2013
Annals of Aquaculture and Research
ISSN : 2379-0881
Launched : 2014
Clinical Research in Pulmonology
ISSN : 2333-6625
Launched : 2013
Journal of Immunology and Clinical Research
ISSN : 2333-6714
Launched : 2013
Annals of Forensic Research and Analysis
ISSN : 2378-9476
Launched : 2014
JSM Biochemistry and Molecular Biology
ISSN : 2333-7109
Launched : 2013
Annals of Breast Cancer Research
ISSN : 2641-7685
Launched : 2016
Annals of Gerontology and Geriatric Research
ISSN : 2378-9409
Launched : 2014
Journal of Sleep Medicine and Disorders
ISSN : 2379-0822
Launched : 2014
JSM Burns and Trauma
ISSN : 2475-9406
Launched : 2016
Chemical Engineering and Process Techniques
ISSN : 2333-6633
Launched : 2013
Annals of Clinical Cytology and Pathology
ISSN : 2475-9430
Launched : 2014
JSM Allergy and Asthma
ISSN : 2573-1254
Launched : 2016
Journal of Neurological Disorders and Stroke
ISSN : 2334-2307
Launched : 2013
Annals of Sports Medicine and Research
ISSN : 2379-0571
Launched : 2014
JSM Sexual Medicine
ISSN : 2578-3718
Launched : 2016
Annals of Vascular Medicine and Research
ISSN : 2378-9344
Launched : 2014
JSM Biotechnology and Biomedical Engineering
ISSN : 2333-7117
Launched : 2013
Journal of Hematology and Transfusion
ISSN : 2333-6684
Launched : 2013
JSM Environmental Science and Ecology
ISSN : 2333-7141
Launched : 2013
Journal of Cardiology and Clinical Research
ISSN : 2333-6676
Launched : 2013
JSM Nanotechnology and Nanomedicine
ISSN : 2334-1815
Launched : 2013
Journal of Ear, Nose and Throat Disorders
ISSN : 2475-9473
Launched : 2016
JSM Ophthalmology
ISSN : 2333-6447
Launched : 2013
Journal of Pharmacology and Clinical Toxicology
ISSN : 2333-7079
Launched : 2013
Annals of Psychiatry and Mental Health
ISSN : 2374-0124
Launched : 2013
Medical Journal of Obstetrics and Gynecology
ISSN : 2333-6439
Launched : 2013
Annals of Pediatrics and Child Health
ISSN : 2373-9312
Launched : 2013
JSM Clinical Pharmaceutics
ISSN : 2379-9498
Launched : 2014
JSM Foot and Ankle
ISSN : 2475-9112
Launched : 2016
JSM Alzheimer's Disease and Related Dementia
ISSN : 2378-9565
Launched : 2014
Journal of Addiction Medicine and Therapy
ISSN : 2333-665X
Launched : 2013
Journal of Veterinary Medicine and Research
ISSN : 2378-931X
Launched : 2013
Annals of Public Health and Research
ISSN : 2378-9328
Launched : 2014
Annals of Orthopedics and Rheumatology
ISSN : 2373-9290
Launched : 2013
Journal of Clinical Nephrology and Research
ISSN : 2379-0652
Launched : 2014
Annals of Community Medicine and Practice
ISSN : 2475-9465
Launched : 2014
Annals of Biometrics and Biostatistics
ISSN : 2374-0116
Launched : 2013
JSM Clinical Case Reports
ISSN : 2373-9819
Launched : 2013
Journal of Cancer Biology and Research
ISSN : 2373-9436
Launched : 2013
Journal of Surgery and Transplantation Science
ISSN : 2379-0911
Launched : 2013
Journal of Dermatology and Clinical Research
ISSN : 2373-9371
Launched : 2013
JSM Gastroenterology and Hepatology
ISSN : 2373-9487
Launched : 2013
Annals of Nursing and Practice
ISSN : 2379-9501
Launched : 2014
JSM Dentistry
ISSN : 2333-7133
Launched : 2013
Author Information X