Loading

Annals of Clinical and Medical Microbiology

A Search for Identifying Aerobic Bacteria by Culture and Multiplex PCR in Market Eggs Causing Gastroenteritis and Enteric Fever in Bangladesh

Research Article | Open Access | Volume 1 | Issue 1

  • 1. Department of Microbiology, Dhaka Medical College, Bangladesh
  • 2. Department of Microbiology, Dhaka Medical College, Bangladesh
+ Show More - Show Less
Corresponding Authors
SM Shamsuzzaman, Professor, Department of Microbiology, Dhaka Medical College, Dhaka 1000, Bangladesh, Tel: 880-29665518; Fax: 880-1819289739;
Abstract

To observe the chance of possible transmission of pathogenic bacteria from market egg to the community, potential pathogenic aerobic bacteria were detected from market eggs by culture and multiplex PCR. Egg shells and egg contents of 150 eggs collected from different markets of Dhaka city were tested. Total 145 (96.67%) egg shells yielded growth of bacteria, 23 (15.86%) of them were ESBL producers. Esch. coli was the most common (26.67%) bacteria and 7 (4.67%) were Salmonella spp. Other bacteria were Klebsiella pneumoniae (6.67%), Proteus vulgaris (3.33%), Proteus mirabilis (2%), Providencia rettgeri (15.33%), Providencia alkalifaciens (1.33%), Acinetobacter baumanii (8.67%), Citrobacter freundii (10%), Enterobacter aerogenes (6.67%) Klebsiella oxytoca (4.67%) and Pseudomonas aeruginosa (6.67%). By PCR, 15 (10%) Salmonella spp. was identified from egg shells and the most common serotype was Salmonella Enteritidis (53.33%). No bacteria were detected from egg contents. Most of the bacteria were sensitive to imipenem and colistin. All Salmonella serotypes were sensitive to chloramphenicol, imipenem, gentamicin, ciprofloxacin and ceftriaxone. In conclusion, it can be said that market eggs may be an important source of infection of many gram negative bacteria including Salmonella to the community.

Keywords

•    Aerobic bacteria
•    Bangladesh
•    Culture
•    Escherichia coli
•    Market eggs
•    PCR
•    Salmonella

Citation

Fardows J, Shamsuzzaman SM (2015) A Search for Identifying Aerobic Bacteria by Culture and Multiplex PCR in Market Eggs Causing Gastroenteritis and Enteric Fever in Bangladesh. Ann Clin Med Microbio 1(1): 1001.

INTRODUCTION

Eggs and egg products are nutritive food items and a vital constituent of human food in the world [1]. They are rich in protein, phosphorous, selenium, choline, riboflavin, vitamin B12, folic acid, zinc, pantothenic acid and vitamin A, D, E and K [2]. Inaccurately treated eggs can cause food-borne illness [3]. The intestinal tract of hen is the reservoir of Salmonella spp. as well as other microorganisms which infects human [4]. The absence of standard structures and drainage system in the market and relatively high humidity could have contributed to the high microbial growth [5]. Most retailers do not store eggs in refrigerators, thus the eggs are exposed to weather conditions, resulting in their contamination [6]. Microbial contamination of egg has important outcome to the poultry industry and illness from contaminated egg is a serious public health problem around the world [1]. In spite of the antibacterial factors, it can be infected with different bacteria such as Salmonella spp., Esch coli, Listeria monocytogens, Campylobacter jejuni, Proteus spp. and Klebsiella spp [7]. The shell acquires infection from all surface with which it makes contact. The extent of infection is directly related to the cleanliness of these surfaces, and storage under very humid conditions [8].

It is estimated that in the U.S. Salmonella transmission through contaminated egg shell or egg products results in 48 million cases of salmonellosis and costs $ 365 million annually [9]. Enteric fever and gastroenteritis is a common disease in Bangladesh. Eggs are common food item in every house hold and it may be assumed that eggs may be one of the sources of such infections in Bangladeshi community. Different Salmonella species identified by culture from egg shells have been reported in Bangladesh [10]. But other potential pathogenic bacteria have not been reported yet and no such study has been done on egg contents from market eggs in the country. The present study is carried out to isolate the pathogenic aerobic bacteria including Salmonella from egg shell and egg contents of hen by culture and multiplex PCR and to see their antimicrobial susceptibility pattern.

MATERIALS AND METHODS

This cross sectional study was carried out on egg shells and egg contents of 150 eggs collected from different markets of Dhaka City of Bangladesh. It was done in the department of Microbiology, Dhaka Medical College (DMC), Dhaka, Bangladesh from July, 2012 to June, 2013. Undamaged and clean eggs without fecal contamination and cracks were included in this study.

Sample processing with pre-enrichment and enrichment

For each egg, one sterile swab stick was made wet by TSB. One sterile swab stick was made wet by peptone water broth and shell swab was taken from the entire surface of the egg and was immediately inoculated in a test tube containing 9 ml peptone water broth for pre-enrichment for Salmonella spp. Another shell swab was taken from the entire surface of the egg and was immediately inoculated in a test tube containing 9 ml TSB for enrichment for aerobic bacteria other than Salmonella spp [11]. After collection of shell swabs, same egg was taken for egg contents (egg yolk and white part). Egg surface was sterilized by immersion in 70% alcohol for 2 min in a sterile dish, air dried in a sterile paper for 10 min, then cracked by a sterile spoon. Then carefully egg contents were taken in other sterile dish and mixed thoroughly by sterile mixer. Then, one ml of the mixed egg contents were immediately inoculated in a test tube containing 9 ml TSB for enrichment for aerobic bacteria and one ml egg contents were inoculated in a test tube containing 9 ml peptone water broth for pre-enrichment for Salmonella by sterile disposable syringe [12].

Isolation of organisms

After processing, the enriched (TSB) and pre-enriched media (PWB) were incubated at 37° C for 24 hours. Then one or two loopful inoculum was streaked on MacConkey’s agar media and blood agar media from TSB and again incubated at 37° C for 24 hours. Subculture was done by taking one ml peptone water broth culture to a test tube containing fresh TSB and incubated for 24 hours at 37° C for enrichment for Salmonella spp. Then one or two loopful inoculum was streaked on MacConkey’s agar media, XLD agar media and Salmonella-Shigella agar media from TSB and incubated at 37° C for 24 hours. All the plates were examined after 24 hours for visible colony of bacteria [11,12].

Identification of organisms

All the isolated organisms were identified by their colony morphology, staining characters and further confirmed by relevant biochemical tests including oxidase test, reactions in Triple Sugar Iron (TSI) agar media, Simmon’s citrate agar media, motility indole urea (MIU) media and sugar fermentation test. Esch. coli was identified by observing pink colony on MacConkey’s agar media with acid slant and butt in TSI media, motile, indole positive and urease negative reaction in MIU media with oxidase and citrate negative. Salmonella species were identified as pale colony in MacConkey’s agar media with acid butt and alkaline slant with or without H2 S and gas production in TSI media, indole, urease and oxidase negative and sugar (lactose & sucrose) fermentation test negative [10].

Antibiotic susceptibility test

Using Kirby-Bauer modified disc-diffusion technique, antibiotic susceptibility test was performed and as described by Clinical and Laboratory standards Institute [13,14]. Antibiotics used were ceftazidime (30µg⁄disc), cetriaxone (30µg⁄disc), imipenem (10µg⁄disc), amoxiclav (amoxicillin and clavulanic acid), (20⁄10µg), ciprofloxacin (5µg⁄disc), amikacin (30µg⁄disc), colistin sulphate (10µg⁄disc), cefixime (30µg⁄disc), gentamicin (10µg⁄disc), piperacillin (30µg/disc), carbenicillin (30µg/ disc), (chloramphenicol (30µg/disc), azithromycin (15µg/disc) and nalidixic acid (30µg/disc) (Oxoid Ltd. UK). Pure colonies of isolated organisms were emulsified in normal saline and turbidity was matched with 0.5 McFarland turbidity standards. Selected antibiotic discs were placed on inoculated Mueller Hinton agar media. These plates were incubated at 37° C for 24 hours. Resistant and sensitive bacteria were defined according to CLSI guidelines.

Detection of ESBL producing bacteria by double disc synergy assay

Disc containing 30µg of ceftazidime and a disc containing amoxicillin plus clavulanic acid (20µg + 10µg) were placed 15 to 20 mm apart from center to center on Muller Hinton agar media and the plate was incubated at 37° C for 24 hours. A clear extension of the edge of inhibition zone of cephalosporin disc towards amoxicillin plus clavulanic acid disc was interpreted as ESBL production [15].

Polymerase chain reaction (PCR)

1.5 ml pre-enriched peptone water broth was taken in a sterile micro-centrifuge tube, vortexed until mixing and centrifuged at 10000 g for 10 minutes, supernatant were discarded and the pellets were re-suspended in 100 µl sterile distilled water, heated at 100° C for 10 minutes in a heat block, then immediately placed on ice for 5 minutes and centrifuged at 14000 g at 4° C for 10 minutes, supernatant were taken into another microcentrifuge tube and were used for DNA template for PCR [12]. At first Salmonella spp. was identified by detecting genus specific invA gene. Then different Salmonella serotypes were identified by detecting different serotypes specific genes. The following cycling parameters were used: initial denaturation at 94° C for 10 minutes, then 35 cycles each consisted of denaturation at 94° C for one minute, annealing for 60 seconds at 65° C for Salmonella spp. and Salmonella Typhimurium, 56° C for Salmonella Enteritidis, 55° C for Salmonella Typhi and Salmonella Paratyphi A and extension at 72° C for 30 seconds. After 35 cycles, one cycle of final extension was done at 72° C for 10 minutes. Electrophoresis was done at 100 volts for 35 minutes after loading in to 1.5% agarose gel, stained with 1% ethidium bromide, destained in distilled water for 20 min and visualized under UV transillumination. Primers with base pairs used in this study are s in shown in table 1.

Table 1: Serotypes of Salmonella with their genes, primers and their amplified product used in the study.

Name Genes Pr primers Sequence (5' -3' ) Base pair
Salmonella spp. invA[16] fliC-s F-ATAGCCATCTTTACCAGTTCCCCC 284 bp
fliC-as R-GCTGCAACTGTTACAGGAATATGCC  
Salmonella Typhimurium fliC[16] fliC-s F- ATAGCCATCTTTACCAGTTCCCCC 183 bp
fliC-as R- GCTGCAACTGTTACAGGAATATGCC  
Salmonella Enteritidis sefA[17] SEFA2 F-GCAGCGGTTACTATTGCAGC 310 bp
SEFA4 R-TGTACAGGGACATTTAGCG  
Salmonella Typhi (O antigen) tyv[18] tyv-s F-GAGGAAGGGAAATGAAGCTTTT 615 bp
tyv-as R- TAGCAAACTGTCTCCCACCATAC  
Salmonella Paratyphi A (O antigen) prt[18] parat-s F-CTTGCTATGGAAGACATAACGAAC 258 bp
parat-as R-CGTCTCCATCAAAAGCTCCATAGA  
Salmonella Typhi (H antigen) fliC[18] fliCcom-s F-AATCAACAACAACCTGCAGCG 750 bp
fliCd-as R-GCATAGCCACCATCAATAACC  
Salmonella Paratyphi A (H antigen) fliC[18] fliCcom-s F-AATCAACAACAACCTGCAGCG 329 bp
fliCd-as R-TAGTGCTTAATGTAGCCGAAGG  

Data analysis

After compiling data were analyzed using `Microsoft Office Excel 2007 program and X² test was used to compare the results.

RESULTS

Although no egg contents of eggs collected from market yielded growth of any bacteria, 145 (96.67%) egg shells yielded growth of different bacteria. Among the isolated aerobic bacteria Esch. coli was the most common organism (26.67%) and 7 (4.67%) were Salmonella spp. (Table 2).

Table 2: Frequencies of microbial isolates from egg shells among market eggs (n=150) and distribution of ESBL producing bacteria by DDS test among them.

Types of isolates

n (%)

ESBL producer’s n (%)

Esch. coli

40 (26.67)

9 (39.13)

Providencia rettgeri

23 (15.33)

4 (17.39)

Providencia alkalifaciens

2 (1.33)

1 (4.35)

Citrobacter freundii

15 (10.00)

-

Enterobacter aerogenes

10 (6.67)

-

Klebsiella pneumonia

10 (6.67)

2 (8.70)

Klebsiella oxytoca

7 (4.67)

-

Pseudomonas aeruginosa

10 (6.67)

3 (13.04)

Acinetobacter baumanii

13 (8.67)

-

Proteus vulgaris

5 (3.33)

3 (13.04)

Proteus mirabilis

3 (2.00)

1 (4.35)

Salmonella Typhi

1 (0.67)

-

Salmonella Paratyphi A

1 (0.67)

-

Others Salmonella

5 (3.33)

-

Total

145 (96.67)

23 (100)

Tweenty three (15.86%) ESBL producing bacteria were identified from 145 gram negative bacteria.

Total 15 (10.00%) egg shells were positive for Salmonella by PCR and all the egg contents were negative for Salmonella DNA (Table 3).

Table 3: Identification of different Salmonella serotypes by PCR among the samples which were positive for Salmonella DNA in market egg shells (n=15).

Name of serotypes

Number of positive

Percentage

Salmonella Enteritidis
Salmonella Typhimurium 

8
2

53.33
13.33

Salmonella Typhi

1

6.67

Salmonella Paratyphi A

1

6.67

Unidentified Salmonella

3

20.00

Total

15

100.00

Salmonella Enteritidis was the most common Salmonella serotype (53.33%) detected from egg shells by PCR (Figure 1).

Figure 1 Photograph of amplified DNA of different serotypes of  Salmonella. Negative control Esch. coli ATCC 25922 (lane 1). Amplified  DNA of 183 bp for fliC gene of Salmonella Typhimurium. (lane 2), 284  bp for invA gene of Salmonella spp. (lane 3), 329 bp and 258 bp for fliC and prt gene of Salmonella Paratyphi A (lane 5), 750 bp and 615 bp  for fliC and tyv gene of Salmonella Typhi respectively (lane 6) and 310  bp for sefA gene of Salmonella Enteritidis (lane 7). Hundred base pair  DNA (lane 4).

Figure 1: Photograph of amplified DNA of different serotypes of Salmonella. Negative control Esch. coli ATCC 25922 (lane 1). Amplified DNA of 183 bp for fliC gene of Salmonella Typhimurium. (lane 2), 284 bp for invA gene of Salmonella spp. (lane 3), 329 bp and 258 bp for fliC and prt gene of Salmonella Paratyphi A (lane 5), 750 bp and 615 bp for fliC and tyv gene of Salmonella Typhi respectively (lane 6) and 310 bp for sefA gene of Salmonella Enteritidis (lane 7). Hundred base pair DNA (lane 4).

Of the 150 egg shells, 6 (85.71%) were positive by both culture and PCR (Table 4). Considering culture as gold standard, the sensitivity of PCR was 85.71%, specificity was 93.70%, positive predictive value was 40%, negative predictive value was 99.25% and accuracy was 93.33%. PCR detected significantly higher number of Salmonella than culture (p<0.001).

Most of the gram negative bacteria other than Salmonella were resistant to ciprofloxacin (Table 5). All Salmonella serotypes were sensitive to chloramphenicol, imipenem, gentamicin, ciprofloxacin and ceftriaxone (Table 6).

DISCUSSION

Microbial contamination of egg has important outcome to the poultry industry and illness from contaminated egg is a serious public health problem around the world [5]. Though all gram negative bacteria can contaminate eggs but Salmonella is a major food-borne pathogen worldwide and contaminates poultry products especially eggs and egg products [19]. Gastroenteritis and enteric fever are the major causes of infections transmitted by feco oral route in Bangladesh. Eggs are considered as a major source of protein and vitamins for everybody. Eggs are bought from the market and brought every kitchen irrespective of assessing whether it carries harmful bacteria or not. So the gastroenteritis and enteric fever germs may be transmitted from contaminated eggs.

In the present study, 96.67% egg shells yielded growth of pathogenic bacteria which coincide with a study where it was reported that 95% egg shells yielded growth of different bacteria from eggs collected from market [11]. These bacterial contaminations might be from cloths and hands of poultry and market workers, market retailers, use of same tray and environment of the market [20]. In the developing countries especially Bangladesh, during the market storing, inadequate refrigeration even no refrigeration can increase the percentage of different bacterial contamination on egg shell.

In the present study, among the isolated aerobic bacteria, 26.67% were Esch. coli. In Nigeria, relatively higher percentage of Esch.coli (27.5%) was observed [21]. Though Esch. coli is a normal flora of intestinal tract of birds and it is of low risk for human as it is also a member of normal commensal of human gut but chickens may be colonized with enterohaemorrhagic Esch. coli O157: H7 strain (EHEC), transmission of which in human may cause severe haemorrhagic colitis and haemolytic uremic syndrome [11]. Other diarrhoeagenic Esch. coli like enterotoxigenic Esch. coli (ETEC), enteropathogenic Esch.coli (EPEC), enteroinvasive Esch. coli (EIEC), enteroaggregative Esch. coli (EagEC) and diffusely adherent Esch. coli may also contaminate egg shell from the farm handlers and environment and may cause watery and bloody diarrhoea. In this study, however, attempt to detect these diarrhoeagenic strains was not made.

Enteric fever is endemic in Indian subcontinent including Bangladesh [22]. It is known that Salmonella transmission occurs mainly by food and drink. So, egg might be an important source of Salmonella transmission. In addition to other gram negative bacteria, 7 (4.67%) Salmonella spp. was isolated by culture and 15 (10%) Salmonella DNA were detected by PCR in this study. Previous studies in Bangladesh reported 8%-12% Salmonella from egg. [10,23]. However, prevalence of different Salmonella serotype was not reported in detail in those studies.

Drug resistance is a major problem in treating the infectious diseases and drug resistance pattern among the isolated organisms have been evaluated in the present study. Among the isolated bacteria in this study, 15.86% were ESBL producers and 6.21% of them were Esch. coli. In contrast to the present study, no ESBL producers were observed among 72 egg shells [24]. The exact cause of absence of ESBL producing bacteria in that study is not known. In the EU, washing egg procedures are not allowed, but other processes (gaseous ozone, chloride ultraviolet radiation, dirty eggs exclusion) are applied in order to reduce the coliform load, which may contribute to the absence of ESBL producers in egg shells in those countries [25,26]. But in our country, unhygienic practice of market retailers and unethical practice of antibiotics may increase the egg shell contamination and similarly increase the ESBL carrying bacteria in the community. However, Smet et al. observed 45% ESBL producers in cloacal sample of broilers in their study where all isolates were Esch. Coli [26].

In the present study, most of the identified Salmonella species were gastroenteritis producing Salmonella ( 53.33% Salmonella Enteritidis and 13.33% Salmonella Typhimurium). Enteric fever producing Salmonella species such as, Salmonella Typhi and Salmonella Paratyphi A were also identified but in relatively lower percentage. In India, 29.09% Salmonella Enteritidis and 1.5% Salmonella Typhimurium was observed in egg shell [27,28]. In the present study, serotype could not be identified in 2 (14.29%) Salmonella from egg shell detected by genus specific PCR. These negative findings might be due to the fact that we did not use all primers of other Salmonella [29].

Sensitivity and specificity of PCR in detecting Salmonella species in the present study is similar to other study [30]. In this study, one Salmonella strain isolated by culture was negative in PCR. The reason of such negative PCR result in isolated Salmonella might be due to the fact that invA gene was detected in PCR in this study to detect Salmonella and these culture positive Salmonella strains might have invB or himA gene [31] and PCR used in this study could not detect these genes. The higher sensitivity of PCR than culture is due to culture needs live bacteria but PCR can detect DNA of both live and dead bacteria [32].

Ciprofloxacin, combination of amoxicillin and clavulanic acid and imipenem are usually being used to treat ESBL producing gram negative bacteria in Bangladesh. But bacteria is developing resistance to these antibiotics rapidly which is evidenced by the fact that 84.62% bacteria were susceptible to imipenem in the present study and 100% bacteria other than Salmonella were resistant to amoxicillin plus clavulanic acid and ciprofloxacin. The reason of development of resistance to these drugs might be due to the fact that antibiotics are sold over the counter in Bangladesh and anybody can buy it without physician’s prescription and in most of the cases they discontinue after partial cure. Now colistin is the most effective drug to treat these drug resistant bacteria which was effective against 100% isolated bacteria. On the other hand, 100% Salmonella serotypes were sensitive to chloramphenicol, ciprofloxacin and ceftiraxone in the present study. In Bangladesh ceftriaxone resistant Salmonella Typhi and Paratyphi has not yet been reported from human cases [33].

Table 4: Comparison between results of culture and PCR for Salmonella spp. in egg shells among eggs collected from markets.

  Culture  
PCR Positive n (%)   Negative n (%) Total n (%)
Positive 6 (85.71)   9 (6.29) 15 (10.00)
Negative 1 (14.29)   134 (93.71) 135 (90.00)
Total 7 (100.00)   143 (100.00) 150 (100.00)

Table 5: Antimicrobial resistance pattern of isolated gram negative bacteria to different antibiotics.

Antimicrobial Drugs Esch. coli (n=40) Providencia spp. (n=25) Citrobacter freundii (n=15) Klebsiella spp. (n=17) Proteus spp. (n=8) Enterobacter aerogenes (n=10) Acinetobacter baumanii (n=13) Pseudomonas aeruginosa (n=10)
Imipenem 0 (0.00) 0 (0.00) 0 (0.00) 0 (0.00) 0 (0.00) 0 (0.00) 2 (15.38) 3 (30.00)
Amikacin 14 (35.00) 15 (60.00) 10 (66.67) 10 (58.82) 6 (75.00) 5 (50.00) 13 (100.00) 8 (80.00)
Ciprofloxacin 35 (87.50) 22 (88.88) 13 (86.67) 15 (88.24) 7 (87.50) 8 (90.00) 13 (100.00) 10 (100.00)
Ceftriaxone 10 (25.00) 12 (48.00) 10 (66.67) 5 (29.41) 3 (37.50) 3 (30.00) 11 (84.62) 8 (80.00)
Ceftazidime 20 (50.00) 10 (40.00) 8 (53.33) 5 (29.41) 3 (37.50) 3 (30.00) 11 (84.62) 7 (70.00)
Cefixime 20 (50.00) 10 (40.00) 8 (53.33) 5 (29.41) 5 (62.50) 2 (20.00) 13 (100.00) 8 (80.00)
Gentamicin 10 (25.00) 15 (60.00) 10 (66.67) 12 (70.59) 5 (62.50) 7 (70.00) 13 (100.00) 7 (70.00)
Colistin 0 (0.00) 0 (0.00) 0 (0.00) 0 (0.00) 0 (0.00) 0 (0.00) 0 (0.00) 2 (20.00)
Amoxyclav (amoxicillin and clavulanic acid) 25 (62.50) 20 (80.00) 12 (80.00) 10 (58.82) 6 (75.00) 6 (60.00) 13 (100.00) 8 (80.00)
PiPiperacillin 3 (30.00)
CaCarbenicillin 10 (100.00)

Table 6: Antimicrobial resistance pattern of different serotypes of Salmonella.

A Antibiotics S. Enteritidis n (%) S.Typhimurium n (%) S. Typhi n (%) S. Paratyphi A n (%)
Chloramphenicol 0(0.00) 0(0.00) 0 (0.00) 0 (0.00)
Nalidixic acid 7 (83.33) 2 (100.00) 0 (0.00) 0 (0.00)
Imipenem 0 (0.00) 0 (0.00) 0 (0.00) 0 (0.00)
Amikacin 4 (50.00) 2 (100.00) 1 (100.00) 1 (100.00)
Ciprofloxacin 0 (0.00) 0 (0.00) 0 (0.00) 0 (0.00)
Gentamicin 0 (0.00) 0 (0.00) 0 (0.00) 0 (0.00)
Ceftriaxone 0 (0.00) 0 (0.00) 0 (0.00) 0 (0.00)
Azithromycin 6 (33.33) 0 (0.00) 0 (0.00) 0 (0.00)
Amoxyclav (amoxicillin and clavulanic acid) 7 (83.33) 2 (100.00) 1 (100.00) 0 (0.00)

 

CONCLUSION

Eggs may be a source of transmission of different gram negative bacteria from market to the community. PCR is the sensitive method to detect Salmonella in culture negative samples. Early detection and proper hygienic practice should be maintained in handling and marketing eggs by the farm handlers and retailers to prevent spread of infection of different gram negative bacteria including Salmonella to the community. Ceftriaxone, ciprofloxacin and chloramphenicol are the most effective drugs against Salmonella and colistin is the most effective drug against other gram negative bacteria isolated from market eggs.

ACKNOWLEDGEMENT

This work was supported by the department of Microbiology of Dhaka Medical College, Dhaka, Bangladesh.

REFERENCES

1. Stepie?-Py?niak D. Occurrence of gram-negative bacteria in hens’ eggs depending on their source and storage conditions. Pol J Vet Sci. 2010; 13: 507-513.

2. Anonymous. Report of the survey of Salmonella contamination of UK produced shell eggs on retail sale. Food Standards Agency. HMSO, London, UK; 2004.

3. Musgrove MT, Northcutt JK, Jones DR, Cox NA, Harrison MA. Enterobacteriaceae and related organisms isolated from shell eggs collected during commercial processing. Poult Sci. 2008; 87: 1211- 1218.

4. Khan WA, Khan MZ, Khan A, Hussain I. Pathological effects of aflatoxin and their amelioration by vitamin E in White Leghorn Layers. Pak Vet J. 2010; 30: 155-162.

5. Safaei G, Jalali M, Hosseini A, Narimani T, Sharifzadeh A, Raheim E. The prevalence of bacterial contamination of table eggs from retails markets by Salmonella spp., Listeria monocytogenes, Campylobacter jejuni and Esch coli in Shhrekord, Iran. Jundishapur J Microbiol. 2011; 4: 249- 253.

6. Addey S, Ansah TGSK, Dzoagbe GA, Teye S, Danquah JK. Microbial quality of table eggs sold on selected markets in the Tamale Municipality in the Northern Region of Ghana. Res Rural Dev. 2009; 21: 8.

7. Mahdavi M, Jalali M, Safaei HG, Shamloo E. Microbial quality and prevalence of Salmonella and Listeria in eggs. Int J Envior Health Eng. 2012; 1: 6.

8. Al-Ashmawy MAM. Prevalence of Enterobacteriaceae in table eggs with particular reference to enterovirulent Esch. coli strain. Int J Poult Sci. 2013; 12 : 430-435.

9. CDC (Center for Disease Control and Prevention). Salmonella in egg: An Unwelcome summer visitor. Atlanta: Center for Disease Control and Prevention. 2013.

10. Ahmed MM, Rhaman MM, Mahbub KR, Wahiduzzaman M. Characterization of antibiotic resistant Salmonella spp. isolated from chicken eggs of Dhaka city. J Sci Res. 2011; 3: 191-196.

11. Abdullah IN. Isolation and identification of some bacterial isolates from table egg. J Net Sci. 2010; 3: 1025- 1031.

12. Loongyai W, Promphet K, Kangsukul N, Noppha R. Detection of Salmonella in egg shell and egg content from different housing systems for laying hens. World Acade Sci Eng Technol. 2010; 41.

13. Bauer AW, Kirby WM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol. 1966; 45: 493-496.

14. CLSI (Clinical and Laboratory Standard Institute). Performance Standards for Antimicrobial Disc Susceptibility testing; Twenty-first informational supplement. CLSI document M100-S21. Wayne, PA: CLSI; 2011.

15. Collee JG, Fraser AG, Marimon B, Simmons A. Test for the identification of bacteria. In: Collee JG, Miles RS, Watt B (eds). Mackie McCartney Practical Medical Microbiology. 14th ed. Churchill. Livingstone. New York; 1996: 132-149.

16. Rahn K, De Grandis SA, Clarke RC, McEwen SA, Galán JE, Ginocchio C, et al. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes. 1992; 6: 271-279.

17. Madadi MS, Azari M, Yazdani A. Evaluation of different plating medias and PCR in the detecting of Salmonella Enteritidis from eggs laid by Experimentally infected hens. J Anim Poult Sci. 2012; 1: 13-23.

18. Hirose K, Itoh K, Nakajima H, Kurazono T, Yamaguchi M, Moriya K, et al. Selective amplification of tyv (rfbE), prt (rfbS), viaB, and fliC genes by multiplex PCR for identification of Salmonella enterica serovars Typhi and Paratyphi A. J Clin Microbiol. 2002; 40: 633-636.

19. Foley SL, Nayak R, Hanning IB, Johnson TJ, Han J, Ricke SC, et al. Population dynamics of Salmonella enterica serotypes in commercial egg and poultry production. Appl Environ Microbiol. 2011; 77: 4273- 4279.

20. De Reu K, Grijspeerdt K, Heyndrickx M, Zoons J, De Baere K, Uyttendaele M, et al. Bacterial eggshell contamination in conventional cages, furnished cages and aviary housing systems for laying hens. Br Poult Sci. 2005; 46: 149-155.

21. Mai HM, Zahraddeen D, Qadeers MA, Bawa IA, Echeonwu IE. Investigation of Some Species of Salmonella in Table Eggs sold at Different Markets in Jos South, Plateau State, Nigeria. Glo Adv Res J Microbiol. 2013; 2: 234-238.

22. Dewan AM, Corner R, Hashizume M, Ongee ET. Typhoid Fever and its association with environmental factors in the Dhaka Metropolitan Area of Bangladesh: a spatial and time-series approach. PLoS Negl Trop Dis. 2013; 7: 1998.

23. Monzur MA, Siddique H, Khandaker RM, Himel NK. Performance analysis of multiplex PCR based detection of Salmonella spp. and Salmonella Typhimurium in chicken egg sample. J Sci Res. 2012; 2: 25-32.

24. Egea P, López-Cerero L, Navarro MD, Rodríguez-Baño J, Pascual A. Assessment of the presence of extended-spectrum beta-lactamase producing Escherichia coli in eggshells and ready-to-eat products. Eur J Clin Microbiol Infect Dis. 2011; 30: 1045-1047.

25. Mesa RJ, Blanc V, Blanch AR, Cortes P, Gonzalez JJ, Lavilla S, et al. Extended-spectrum beta-lactamase-producing Enterobacteriaceae in different environments (humans, food, animal farms and sewage). J Antimicrobiol Chemother. 2006; 58: 211-215.

26. Smet A, Martel A, Persoons D, Dewulf J, Heyndrickx M, Catry B, et al. Diversity of extended-spectrum beta-lactamases and class C beta lactamases among cloacal Escherichia coli Isolates in Belgian broiler farms. Antimicrob Agents Chemother. 2008; 52: 1238-1243.

27. Day JB, Basavanna U, Sharma SK. Development of a cell culture method to isolate and enrich Salmonella enterica serotype enteritidis from shell eggs for subsequent detection by real-time PCR. Appl Environ Microbiol. 2009; 75: 5321-5327.

28. Nagappa K, Shantanu T, Brajmadhuri, Saxena MK, Singh SP. Isolated of Salmonella Typhimurium from poultry eggs and meat of Tarai region of Uttaranchal. Indian J Biotech. 2007: 407-409.

29. Pui CF, Wong WC, Chai LC, Tunung R, Ubong A, Cheah Y. Review article of Salmonella: a foodborne pathogen. Int food Res J. 2011; 18: 465- 473.

30. Oliveira SD, Santos LR, Schuch DM, Silva AB, Salle CT, Canal CW. Detection and identification of salmonellas from poultry-related samples by PCR. Vet Microbiol. 2002; 87: 25-35.

31. Jamshidi A, Bassami MR, Afshari-Nic S. Identification of Salmonella spp. and Salmonella Typhimurium by a multiplex PCR-based assay from poultry carcasses in Mashhad- Iran Int. J Vet Res. 2009; 3: 43-48.

32. Gillespie BE, Mathew AG, Draughon FA, Jayarao BM, Oliveri SP. Detection of Salmonella enterica somatic groups C1 and E1 by PCR enzyme-linked immunosorbent assay. J Food Prot. 2003; 66: 2367- 2370.

33. Hasan B, Nahar SG, Akter L, Sale A. Antimicrobial sensitivity pattern of Salmonella Typhi isolated from blood culture in a referral hospital. Bangladesh J Med Microbiol. 2011; 5: 16-20.

Received : 19 Dec 2014
Accepted : 17 Jan 2015
Published : 19 Mar 2015
Journals
Annals of Otolaryngology and Rhinology
ISSN : 2379-948X
Launched : 2014
JSM Schizophrenia
Launched : 2016
Journal of Nausea
Launched : 2020
JSM Internal Medicine
Launched : 2016
JSM Hepatitis
Launched : 2016
JSM Oro Facial Surgeries
ISSN : 2578-3211
Launched : 2016
Journal of Human Nutrition and Food Science
ISSN : 2333-6706
Launched : 2013
JSM Regenerative Medicine and Bioengineering
ISSN : 2379-0490
Launched : 2013
JSM Spine
ISSN : 2578-3181
Launched : 2016
Archives of Palliative Care
ISSN : 2573-1165
Launched : 2016
JSM Nutritional Disorders
ISSN : 2578-3203
Launched : 2017
Annals of Neurodegenerative Disorders
ISSN : 2476-2032
Launched : 2016
Journal of Fever
ISSN : 2641-7782
Launched : 2017
JSM Bone Marrow Research
ISSN : 2578-3351
Launched : 2016
JSM Mathematics and Statistics
ISSN : 2578-3173
Launched : 2014
Journal of Autoimmunity and Research
ISSN : 2573-1173
Launched : 2014
JSM Arthritis
ISSN : 2475-9155
Launched : 2016
JSM Head and Neck Cancer-Cases and Reviews
ISSN : 2573-1610
Launched : 2016
JSM General Surgery Cases and Images
ISSN : 2573-1564
Launched : 2016
JSM Anatomy and Physiology
ISSN : 2573-1262
Launched : 2016
JSM Dental Surgery
ISSN : 2573-1548
Launched : 2016
Annals of Emergency Surgery
ISSN : 2573-1017
Launched : 2016
Annals of Mens Health and Wellness
ISSN : 2641-7707
Launched : 2017
Journal of Preventive Medicine and Health Care
ISSN : 2576-0084
Launched : 2018
Journal of Chronic Diseases and Management
ISSN : 2573-1300
Launched : 2016
Annals of Vaccines and Immunization
ISSN : 2378-9379
Launched : 2014
JSM Heart Surgery Cases and Images
ISSN : 2578-3157
Launched : 2016
Annals of Reproductive Medicine and Treatment
ISSN : 2573-1092
Launched : 2016
JSM Brain Science
ISSN : 2573-1289
Launched : 2016
JSM Biomarkers
ISSN : 2578-3815
Launched : 2014
JSM Biology
ISSN : 2475-9392
Launched : 2016
Archives of Stem Cell and Research
ISSN : 2578-3580
Launched : 2014
JSM Pediatric Surgery
ISSN : 2578-3149
Launched : 2017
Journal of Memory Disorder and Rehabilitation
ISSN : 2578-319X
Launched : 2016
JSM Tropical Medicine and Research
ISSN : 2578-3165
Launched : 2016
JSM Head and Face Medicine
ISSN : 2578-3793
Launched : 2016
JSM Cardiothoracic Surgery
ISSN : 2573-1297
Launched : 2016
JSM Bone and Joint Diseases
ISSN : 2578-3351
Launched : 2017
JSM Bioavailability and Bioequivalence
ISSN : 2641-7812
Launched : 2017
JSM Atherosclerosis
ISSN : 2573-1270
Launched : 2016
Journal of Genitourinary Disorders
ISSN : 2641-7790
Launched : 2017
Journal of Fractures and Sprains
ISSN : 2578-3831
Launched : 2016
Journal of Autism and Epilepsy
ISSN : 2641-7774
Launched : 2016
Annals of Marine Biology and Research
ISSN : 2573-105X
Launched : 2014
JSM Health Education & Primary Health Care
ISSN : 2578-3777
Launched : 2016
JSM Communication Disorders
ISSN : 2578-3807
Launched : 2016
Annals of Musculoskeletal Disorders
ISSN : 2578-3599
Launched : 2016
Annals of Virology and Research
ISSN : 2573-1122
Launched : 2014
JSM Renal Medicine
ISSN : 2573-1637
Launched : 2016
Journal of Muscle Health
ISSN : 2578-3823
Launched : 2016
JSM Genetics and Genomics
ISSN : 2334-1823
Launched : 2013
JSM Anxiety and Depression
ISSN : 2475-9139
Launched : 2016
Clinical Journal of Heart Diseases
ISSN : 2641-7766
Launched : 2016
Annals of Medicinal Chemistry and Research
ISSN : 2378-9336
Launched : 2014
JSM Pain and Management
ISSN : 2578-3378
Launched : 2016
JSM Women's Health
ISSN : 2578-3696
Launched : 2016
Clinical Research in HIV or AIDS
ISSN : 2374-0094
Launched : 2013
Journal of Endocrinology, Diabetes and Obesity
ISSN : 2333-6692
Launched : 2013
Journal of Substance Abuse and Alcoholism
ISSN : 2373-9363
Launched : 2013
JSM Neurosurgery and Spine
ISSN : 2373-9479
Launched : 2013
Journal of Liver and Clinical Research
ISSN : 2379-0830
Launched : 2014
Journal of Drug Design and Research
ISSN : 2379-089X
Launched : 2014
JSM Clinical Oncology and Research
ISSN : 2373-938X
Launched : 2013
JSM Bioinformatics, Genomics and Proteomics
ISSN : 2576-1102
Launched : 2014
JSM Chemistry
ISSN : 2334-1831
Launched : 2013
Journal of Trauma and Care
ISSN : 2573-1246
Launched : 2014
JSM Surgical Oncology and Research
ISSN : 2578-3688
Launched : 2016
Annals of Food Processing and Preservation
ISSN : 2573-1033
Launched : 2016
Journal of Radiology and Radiation Therapy
ISSN : 2333-7095
Launched : 2013
JSM Physical Medicine and Rehabilitation
ISSN : 2578-3572
Launched : 2016
Annals of Clinical Pathology
ISSN : 2373-9282
Launched : 2013
Annals of Cardiovascular Diseases
ISSN : 2641-7731
Launched : 2016
Journal of Behavior
ISSN : 2576-0076
Launched : 2016
Annals of Clinical and Experimental Metabolism
ISSN : 2572-2492
Launched : 2016
Clinical Research in Infectious Diseases
ISSN : 2379-0636
Launched : 2013
JSM Microbiology
ISSN : 2333-6455
Launched : 2013
Journal of Urology and Research
ISSN : 2379-951X
Launched : 2014
Journal of Family Medicine and Community Health
ISSN : 2379-0547
Launched : 2013
Annals of Pregnancy and Care
ISSN : 2578-336X
Launched : 2017
JSM Cell and Developmental Biology
ISSN : 2379-061X
Launched : 2013
Annals of Aquaculture and Research
ISSN : 2379-0881
Launched : 2014
Clinical Research in Pulmonology
ISSN : 2333-6625
Launched : 2013
Journal of Immunology and Clinical Research
ISSN : 2333-6714
Launched : 2013
Annals of Forensic Research and Analysis
ISSN : 2378-9476
Launched : 2014
JSM Biochemistry and Molecular Biology
ISSN : 2333-7109
Launched : 2013
Annals of Breast Cancer Research
ISSN : 2641-7685
Launched : 2016
Annals of Gerontology and Geriatric Research
ISSN : 2378-9409
Launched : 2014
Journal of Sleep Medicine and Disorders
ISSN : 2379-0822
Launched : 2014
JSM Burns and Trauma
ISSN : 2475-9406
Launched : 2016
Chemical Engineering and Process Techniques
ISSN : 2333-6633
Launched : 2013
Annals of Clinical Cytology and Pathology
ISSN : 2475-9430
Launched : 2014
JSM Allergy and Asthma
ISSN : 2573-1254
Launched : 2016
Journal of Neurological Disorders and Stroke
ISSN : 2334-2307
Launched : 2013
Annals of Sports Medicine and Research
ISSN : 2379-0571
Launched : 2014
JSM Sexual Medicine
ISSN : 2578-3718
Launched : 2016
Annals of Vascular Medicine and Research
ISSN : 2378-9344
Launched : 2014
JSM Biotechnology and Biomedical Engineering
ISSN : 2333-7117
Launched : 2013
Journal of Hematology and Transfusion
ISSN : 2333-6684
Launched : 2013
JSM Environmental Science and Ecology
ISSN : 2333-7141
Launched : 2013
Journal of Cardiology and Clinical Research
ISSN : 2333-6676
Launched : 2013
JSM Nanotechnology and Nanomedicine
ISSN : 2334-1815
Launched : 2013
Journal of Ear, Nose and Throat Disorders
ISSN : 2475-9473
Launched : 2016
JSM Ophthalmology
ISSN : 2333-6447
Launched : 2013
Journal of Pharmacology and Clinical Toxicology
ISSN : 2333-7079
Launched : 2013
Annals of Psychiatry and Mental Health
ISSN : 2374-0124
Launched : 2013
Medical Journal of Obstetrics and Gynecology
ISSN : 2333-6439
Launched : 2013
Annals of Pediatrics and Child Health
ISSN : 2373-9312
Launched : 2013
JSM Clinical Pharmaceutics
ISSN : 2379-9498
Launched : 2014
JSM Foot and Ankle
ISSN : 2475-9112
Launched : 2016
JSM Alzheimer's Disease and Related Dementia
ISSN : 2378-9565
Launched : 2014
Journal of Addiction Medicine and Therapy
ISSN : 2333-665X
Launched : 2013
Journal of Veterinary Medicine and Research
ISSN : 2378-931X
Launched : 2013
Annals of Public Health and Research
ISSN : 2378-9328
Launched : 2014
Annals of Orthopedics and Rheumatology
ISSN : 2373-9290
Launched : 2013
Journal of Clinical Nephrology and Research
ISSN : 2379-0652
Launched : 2014
Annals of Community Medicine and Practice
ISSN : 2475-9465
Launched : 2014
Annals of Biometrics and Biostatistics
ISSN : 2374-0116
Launched : 2013
JSM Clinical Case Reports
ISSN : 2373-9819
Launched : 2013
Journal of Cancer Biology and Research
ISSN : 2373-9436
Launched : 2013
Journal of Surgery and Transplantation Science
ISSN : 2379-0911
Launched : 2013
Journal of Dermatology and Clinical Research
ISSN : 2373-9371
Launched : 2013
JSM Gastroenterology and Hepatology
ISSN : 2373-9487
Launched : 2013
Annals of Nursing and Practice
ISSN : 2379-9501
Launched : 2014
JSM Dentistry
ISSN : 2333-7133
Launched : 2013
Author Information X