Loading

Annals of Marine Biology and Research

Arsenic Induced Inflammation and Apoptosis in Liver, HeadKidney and Skin of Gilthead Seabream ( Sparus aurata )

Research Article | Open Access | Volume 1 | Issue 1

  • 1. Department of Cell Biology and Histology, University of Murcia, Spain
+ Show More - Show Less
Corresponding Authors
Esteban MA, Department of Cell Biology and Histology, Faculty of Biology, University of Murcia. 30100 Murcia, Spain Tel: 34-868887665; Fax: 34-868883963
Abstract

 Arsenic is a metal with strong impact on the aquatic environment but its effects on marine fish immunity is little known. In this study, we have evaluated the regulation in the expression of genes encoding important acute-phase proteins (ceruloplasmin, transferrin and vitellogenin), antimicrobial peptides (b-defensin, hepcidin and histone 2B) and apoptosis (caspases 3, 8 and 9) in the skin, liver and head-kidney (HK) of the marine gilthead seabream (Sparus aurata L.) after waterborne As acute exposure for 2 or 10 days. Ceruloplasmin and vitellogenin transcription was significantly increased at 2 days on skin whilst the transferrin gene was down-regulated in HK and skin after 2 and 10 days, respectively. Concerning the antimicrobial peptides, b-defensin and hepcidin were firstly up-regulated in the HK and later they were up-regulated in the skin as well as the histone 2B gene. Finally, apoptosis was induced in all the tissues after As-exposure as indicated by the up-regulation of caspase genes. The data obtained provide an approach for elucidating the different molecular mechanisms induced by arsenic toxicity in marine fish.

Keywords

• Arsenic

• Inflammation

• Apoptosis

• Gilthead seabream (Sparus aurata L.

CITATION

: Cordero H, Guardiola FA, Cuesta A, Meseguer J, Esteban MA (2014) Arsenic Induced Inflammation and Apoptosis in Liver, Head-Kidney and Skin of Gilthead Seabream (Sparus aurata). Ann Mar Biol Res 1(1): 1001

ABBREVIATIONS

As: Arsenic; APPs: Acute-Phase Proteins; AMPs: Antimicrobial Peptides; bd: Beta-Defensin; Cd: Cadmium; cDNA: Complementary Deoxyribonucleic Acid; Cp: Ceruloplasmin; casp: Caspase; ef1a: Elongation Factor 1-Alpha; hamp: Hepcidin; h2b: Histone 2b; HK: Head-Kidney; mRNA: Messenger Ribonucleic Acid; PCR: Polymerase Chain Reaction; Tf: Transferrin; Vg: Vitellogenin.

INTRODUCTION

 Arsenic (As) is a naturally occurring element found in soil, air and water [1,2]. The most toxicologically potent As compounds are inorganic and concretely in the trivalent oxidation state [3]. Most studies to understand the toxicity of As compounds were performed in mammals and is associated with liver, lung and skin cancers in humans [4]. In addition, As induces oxidative stress [5] and apoptosis [6] among other effects. However, less is known about other organisms and, for example, very little is known about the As toxicity in fish biology. The in vitro mechanism of As induced toxicity in fish cell lines (oxidative stress, disruption of mitochondrial potential, apoptosis, etc.) is similar to that observed in mammalian cell lines [7]. In addition, in vivo studies reveal that As caused different histopathological alterations in several tissues as well as alterations of the immune response in fish [8–11]. Focusing on the fish immune response, the scarceavailable information points to macrophages as the main targets for As-toxicity [12,13]. However, other fish immune aspects have been ignored. For example, acute-phase proteins (APPs) are a key component of the innate immune system in teleosts and used as inflammation indicators [14]. In this way, among them, transferrin (Tf) and ceruloplasmin (Cp) are vital [15], whilst others such as vitellogenin (Vg) have recently been suggested with a potential role as acute-phase proteins and microbial peptides [16,17]. During the last years, study of the abundance and role of fish antimicrobial peptides (AMPs) has attracted the interest of researchers due to the great role they play in the fish innate immune response, and they can be perturbed by As [8]

Since very little is known about the specific effects of As at molecular levels on fish, this paper describes, for the first time, inflammatory and apoptotic effects of waterborne As-exposure in the expression of different genes in the liver, head-kidney and skin of gilthead seabream (Sparus aurata). Selected genes were grouped into three categories: acute-phase proteins (ceruloplasmin (cp), transferrin (tf) and vitellogenin (vg)), antimicrobial peptides (β-defensin (bd), hepcidin (hamp) and histone H2B (h2b)) and apoptosis cell-death (caspase-3, -8 and -9 (casp3, 8 and 9)], all relating to the immunity. We aimed to evaluate if the presence of As into the water is capable to modulate gene expression in the gilthead seabream, especially in inflammatory and apoptotic processes.

 

MATERIALS AND METHODS

 Fish, arsenic exposure and sampling

Twenty-four specimens (41.5 ± 18.1 g body weight and 13.7 ± 2.6 cm body-length) of gilthead seabream (Sparus aurata L.), obtained from Doramenor Acuicultura S.L. (Murcia, Spain), were kept in two separate seawater aquaria (250 L). The water was maintained at 20 ± 2°C with a flow rate of 900 l h-1 in closed recirculating system, and 28‰ salinity. The photoperiod was of 12 h light: 12 h dark and fish fed with a commercial pellet diet (Skretting, Spain) at a rate of 2% body weight day-1.

Fish were unexposed (control) or exposed to waterborne arsenic by adding 5µM As2 O3 (Fluka Analytical) into the tank water. Six fish per tank and group were sampled after 2 and 10 days of exposition. Fish were starved for 24 h prior to sampling and sacrificed by an overdose of MS222 (Sandoz, Spain, 100 mg ml-1 water) [18]. Tissue fragments of skin; liver and head-kidney (HK) were obtained and immediately frozen in TRIzol Reagent (Life Technologies) for later RNA isolation. All experimental protocols were approved by the Bioethical Committee of the University of Murcia

Real-time PCR

Relative gene expression was analysed in six fish per treatment using real-time PCR and the 2−ΔΔCT method [19]. Liver, head-kidney and skin RNA was extracted with TRIzol reagent (Life Technologies) following manufacturer’s instructions, quantified and the purity assessed by spectrophotometry; the 260:280 ratios were 1.8-2.0. The RNA was then treated with DNase I (Promega) to remove genomic DNA contamination. Complementary DNA (cDNA) was synthesized from 1 μg of total mRNA using the SuperScript III reverse transcriptase (Life Technologies) with an oligo-dT18 primer. The expression of ten selected genes was analyzed by real-time PCR, which was performed with an ABI PRISM 7500 instrument (Applied Biosystems) using SYBR Green PCR Core Reagents (Applied Biosystems). Reaction mixtures(containing 10 μl of 2xSYBR Green supermix, 5 μl of primers (0.6 μM each) and 5 μl of cDNA template) were incubated for 10 min at 95ºC, followed by 40 cycles of 15 s at 95ºC, 1 min at 60ºC, and finally 15 s at 95ºC, 1 min at 60ºC and 15 s at 95ºC. For each mRNA, gene expression was corrected by the elongation factor 1-alpha (ef1a) content in each sample. The primers used are shown in (Table 1)

Tables:

Table 1: Oligonucleotide primers used for real-time PCR

Gene

Abbreviation

GenBank ID

Primer sequence (5 ® 3)

Elongation factor 1-alpha

ef1a

AF184170

F: CTGTCAAGGAAATCCGTCGT

R: TGACCTGAGCGTTGAAGTTG

Ceruloplasmin

cp

FM145678

F: GATAAGGCGGGTGGGTTTAT

R: GGTGTTCCATATCGGCTGTT

Transferrin

tf

FM158209

F: CAGGACCAGCAGACCAAGTT

R: TGGTGGAGTCCTTGAAGAGG

Vitellogenin

vg

JF309047

F: ATGTCGACCTGTACCCCAAG

R: TTGCCTGCAGGATGATGATA

β-defensin

bd

AF210428

F: CCCCAGTCTGAGTGGAGTGT

R: AATGAGACACGCAGCACAAG

Hepcidin

hamp

CB184616

F: GCCATCGTGCTCACCTTTAT

R: CTGTTGCCATACCCCATCTT

Histone H2B

h2b

AM953480

F: AGACGGTCAAAGCACCAAAG

R: AGTTCATGATGCCCATAGCC

Caspase 8

casp8

AM975716

F: GAACAGGGAGGTCAGCAAAG

R: ACACACGCTTGAGGACGAG

Caspase 9

casp9

AM959613

F: ATAGTTGCCGTCTCGCTCAC

R: TCACGAGATTGCTCCTGTTG

Caspase 3

casp3

EU722334

F: CTGATCTGGATGGAGGCATT

R: AGTAGTAGCCTGGGGCTGTG

and every product size is between 90 and 120 bp according to the design of the primers. In all cases, each PCR was performed with triplicate samples

Statistical analysis

Data are expressed as fold increase (mean ± standard error, SE), obtained by dividing each sample value by the mean control value at the same sampling time. Values higher than 1 express an increase while values lower than 1 express a decrease in the indicated gene. Data were statistically analysed by the t-Student test using SPSS 19 to determine differences between unexposed and exposed groups. Differences were considered statistically significant when p≤0.05

 

 

RESULTS AND DISCUSSION

The expression of the genes encoding positive acute-phase proteins, cp and vg [15], was significantly increased in skin and remained unaltered in head-kidney and liver in fish exposed to As for 2 days (Figure 1).

Figure 1 Expression of genes encoding acute-phase proteins  (ceruloplasmin, cp; transferrin, tf; and vitellogenin, vg) determined  by real-time PCR in liver, head-kidney and skin of gilthead seabream  after 2 (white bars) and 10 (black bars) days of waterborne exposure  to 5 µM arsenic. The bars represent the means ± SEM (n=6) fold  increase relative to control. Asterisks denote significant differences  when p?0.05 between unexposed and As-exposed groups

Figure 1 Expression of genes encoding acute-phase proteins (ceruloplasmin, cp; transferrin, tf; and vitellogenin, vg) determined by real-time PCR in liver, head-kidney and skin of gilthead seabream after 2 (white bars) and 10 (black bars) days of waterborne exposure to 5 µM arsenic. The bars represent the means ± SEM (n=6) fold increase relative to control. Asterisks denote significant differences when p≤0.05 between unexposed and As-exposed groups.

Nevertheless, the putative APP, tf [16,17], gene expression was significantly decreased in HK and skin after 2 and 10 days of exposure, respectively. The most significant changes were found in skin, whilst no significant changes were observed in the expression of APP genes in the liver from Asexposed fish compared to gene expression in control specimens(Figure 1).

Regarding genes encoding AMPs (bd, hamp and h2b), a nonsignificant increase was found in liver whereas bd and hamp expression showed a significant increase in HK after 2 days of As exposure (Figure 2). However, all the AMP genes were upegulated in the skin at 10 days of fish exposition being the greatest differences found for bd and hamp

(Figure 2).

Figure 2 Expression of genes encoding antimicrobial peptides (betadefensin, bd; hepcidin, hamp; and histone H2B, h2b) determined by  real-time PCR in liver, head-kidney and skin of gilthead seabream  after 2 (white bars) and 10 (black bars) days of waterborne exposure  to 5 µM arsenic. The bars represent the means ± SEM (n=6) fold  increase relative to control. Asterisks denote significant differences  when p?0.05 between unexposed and As-exposed groups.

Figure 2 Expression of genes encoding antimicrobial peptides (betadefensin, bd; hepcidin, hamp; and histone H2B, h2b) determined by real-time PCR in liver, head-kidney and skin of gilthead seabream after 2 (white bars) and 10 (black bars) days of waterborne exposure to 5 µM arsenic. The bars represent the means ± SEM (n=6) fold increase relative to control. Asterisks denote significant differences when p≤0.05 between unexposed and As-exposed groups.

Finally, the expression of genes involved in apoptosis cell death seems to play a special role in As toxicity. Two different initiator apoptosis caspase genes (casp8 and casp9) and an executioner apoptotic caspase (casp3) were analyzed. Initiator casp8 gene expression showed a significant increase at 2 days in liver and HK, whilst initiator casp9 gene expression was upregulated in skin of As-exposed fish (Figure 3). casp9 and casp3 transcription was down-regulated at 2 days of As exposure in liver and skin, respectively. Strikingly, executioner apoptosis casp3 expression was statistically significant up-regulated in liver, HK and skin after 10 days of exposure (Figure 3)

Figure 3 Expression of genes involved in apoptosis (caspase-8,  casp8; caspase-9, casp9; and caspase-3, casp3) determined by realtime PCR in liver, head-kidney and skin of gilthead seabream after 2  (white bars) and 10 (black bars) days of waterborne exposure to 5  µM arsenic. The bars represent the means ± SEM (n=6) fold increase  relative to control. Asterisks denote significant differences when  p?0.05 between unexposed and As-exposed groups.

Figure 3 Expression of genes involved in apoptosis (caspase-8, casp8; caspase-9, casp9; and caspase-3, casp3) determined by realtime PCR in liver, head-kidney and skin of gilthead seabream after 2 (white bars) and 10 (black bars) days of waterborne exposure to 5 µM arsenic. The bars represent the means ± SEM (n=6) fold increase relative to control. Asterisks denote significant differences when p≤0.05 between unexposed and As-exposed groups.

Previous results obtained after As-exposure in the gilthead seabream demonstrated histopathological and immunotoxicological effects including increase of hepatosomatic index, liver bioaccumulation, inflammation and cellular vacuolization and apoptotic processes as well as increase in the phagocyte-related immune function in the HK leucocytes [13]. All this led us to investigate the expression of genes related to aspects such as inflammation, immune defence and apoptosis in the liver and HK of gilthead seabream exposed to As. In addition, the skin was chosen in the present work because this organ is an essential protective barrier in innate immune system of fish [20] and the most exposed, and first, to waterborne As.

Therefore, different genes were selected to verify the immune status and apoptotic processes at molecular level in Sparus aurata. We selected the acute-phase protein genes cp, tf and vg as inflammatory and stress indicators for the presence of As in the water, synthesized in liver and expressed in fish HK [14] and also in fish skin [21]. Three antimicrobial peptide genes (bd, hamp and h2b) were selected as innate immune system indicators [22]. To our knowledge, these two aspects have never been evaluated in fish exposed to As. Furthermore, it has been demonstrated that As promotes apoptosis in fish both in vitro [7] and in vivo [23]. Taking this into account, we chose three genes involved inthe apoptotic pathway, two initiator caspase genes (casp8 and casp9), and an executioner apoptotic caspase gene (casp3) [24].

Regarding acute phase response, it was reported that As induced the expression of stress-related genes [5]. Transferrin is considered a negative acute protein in mammals [14]. However, in other study, it was demonstrated that is a positive acute phase protein [21,25] and antimicrobial capacity has also been associated to transferrin in fish [26]. Moreover, transferrin and ceruloplasmin are two of the most important APPs [15,27] which act on iron homeostasis processes in order to increase iron storage to make it unavailable for bacterial growth [28]. Our results in tf and cp gene expression showed no changes in liver but significantly increased in skin after 2 days of As-exposure, suggesting that it may be due to skin inflammation and/or stress. This also occurs with vg which is also considered an APP [16] and is expressed in fish skin [21]. All these data demonstratethat acute As-exposure increases APP gene expression mainly in gilthead seabream skin suggesting inflammation in the most exposed tissue.

Discover of the AMP function in the immune response include the most typical of direct lytic activity against pathogens, but also other important functions such as mediators of inflammation and its modulation [29]. It is well-known that β-defensin is an AMP gene synthesized in HK leucocytes and mostly expressed in fish skin, including the seabream [30]. According to this work, our results show up-regulation in HK after 2 days of As-exposure, which could be indicative of its synthesis by Asactivated phagocytes [13] and later recruitment of these cells to the skin, the tissue in which AMP genes are overexpressed after 10 days. Interestingly, hamp and h2b, also considered AMP in fish [29,31] are up-regulated at the same time of As-exposition in HK and skin, respectively. These findings could indicate that Asinduced expression of AMP genes in the skin could be due to the recruitment of phagocytes from the head-kidney but also the upregulation in skin-resident leucocytes since bd and hamp genes are highly expressed in the skin of naïve seabream specimens [29,30]. Moreover, it has been recently demonstrated that Asexposure causes loss of gap junction [32], which could alter the permeability in the skin barrier of fish allowing pathogen entry with the consequent immune response though new molecular and cellular studies are needed to confirm this hypothesis in fish

Last but not least, apoptosis or programmed cell-death caspase-dependent pathway is executed by caspase-3 after stress cell or damage [33]. Regarding fish, it was reported that As induces apoptosis in liver and HK macrophages of catfish [23,34]. Based on these data and considering previous studies at cellular level in Sparus aurata [13], we analysed casp8, casp9 and casp3 gene expression in liver, HK and skin. Interestingly, only executioner apoptotic caspase, casp3, was up-regulated after 10 days of As-exposure in the three organs. A recent research demonstrated that Cd-exposure induces apoptosis through caspase-3 activation in red common carp [35]. Moreover, specifically with As-exposure, liver and HK apoptotic cells were detected by the caspase-3 activation pathway [10,23], as occurred in the present study. However, apoptotic processes in fish skin are poorly understood [36], and these results suggest an apoptotic effect by caspase-dependent pathway due to upregulation of casp3 expression after 10 days of As-exposure, although further research is needed to conclude the apoptotic molecular pathway induced by As-exposure.

CONCLUSION

The present study reveals alterations in the expression of genes related to acute-phase proteins, antimicrobial peptides and apoptosis cell death after As-exposure in the gilthead seabream, especially in the skin, suggesting inflammation and cell death. Moreover, this research describes the potential function of the skin as an important source of APPs and AMPs. Last, apoptotic processes observed at cellular level in liver by previous studies [13] are now also confirmed at genetic level. These data throw some light into the toxicological mechanisms involved in the As toxicity in fish and reveal the importance of the skin, aspect that has never been considered before in fish.

FUNDING ACKNOWLEDGEMENTS

 H. Cordero wishes to thank the Ministerio de Economía y Competitividad for a F.P.I. fellowship. This work was co-funded by a national project of the Ministerio de Economía y Competitividad (AGL2011-30381-C03-01) and Fundación Séneca de la Región de Murcia (Grupo de Excelencia 04538/GERM/06)

REFERENCES
  1. Huang C, Ke Q, Costa M, Shi X. Molecular mechanisms of arsenic carcinogenesis. Mol Cell Biochem. 2004; 255: 57-66.
  2. Duker AA, Carranza EJ, Hale M. Arsenic geochemistry and health. Environ Int. 2005; 31: 631-641.
  3. Hughes MF, Beck BD, Chen Y, Lewis AS, Thomas DJ. Arsenic exposure and toxicology: a historical perspective. Toxicol Sci. 2011; 123: 305-332.
  4. Lee CH, Liao WT, Yu HS. Aberrant immune responses in arsenical skin cancers. Kaohsiung J Med Sci. 2011; 27: 396-401.
  5. Li M, Cai JF, Chiu JF. Arsenic induces oxidative stress and activates stress gene expressions in cultured lung epithelial cells. J Cell Biochem. 2002; 87: 29-38.
  6. Ray A, Chatterjee S, Mukherjee S, Bhattacharya S. Arsenic trioxide induced indirect and direct inhibition of glutathione reductase leads to apoptosis in rat hepatocytes. Biometals. 2014; 27: 483-494.
  7. Selvaraj V, Armistead MY, Cohenford M, Murray E. Arsenic trioxide (As(2)O(3)) induces apoptosis and necrosis mediated cell death through mitochondrial membrane potential damage and elevated production of reactive oxygen species in PLHC-1 fish cell line. Chemosphere. 2013; 90: 1201–1209.
  8. Hermann AC, Kim CH. Effects of arsenic on zebrafish innate immune system. Mar Biotechnol (NY). 2005; 7: 494-505.
  9. Ghosh D, Bhattacharya S, Mazumder S. Perturbations in the catfish immune responses by arsenic: organ and cell specific effects. Comp Biochem Physiol C Toxicol Pharmacol. 2006; 143: 455-463.
  10. Datta S, Mazumder S, Ghosh D, Dey S, Bhattacharya S. Low concentration of arsenic could induce caspase-3 mediated head kidney macrophage apoptosis with JNK-p38 activation in Clarias batrachus. Toxicol Appl Pharmacol. 2009; 241: 329-338.
  11. Pedlar RM, Ptashynski MD, Wautier KG, Evans RE, Baron CL, Klaverkamp JF. The accumulation, distribution, and toxicological effects of dietary arsenic exposure in lake whitefish (Coregonus clupeaformis) and lake trout (Salvelinus namaycush). Comp Biochem Physiol C Toxicol Pharmacol. 2002; 131: 73–91.
  12. Ghosh D, Datta S, Bhattacharya S, Mazumder S. Long-term exposure to arsenic affects head kidney and impairs humoral immune responses of Clarias batrachus. Aquat Toxicol. 2007; 81: 79-89.
  13. Guardiola FA, Gónzalez-Párraga MP, Cuesta A, Meseguer J, Martínez S, Martínez-Sánchez MJ, et al. Immunotoxicological effects of inorganic arsenic on gilthead seabream (Sparus aurata L.). Aquatic Toxicol. 2013; 134-135: 112–119.
  14. Bayne CJ, Gerwick L. The acute phase response and innate immunity of fish. Dev Comp Immunol. 2001; 25: 725-743.
  15. Peatman E, Baoprasertkul P, Terhune J, Xu P, Nandi S, Kucuktas H, et al. Expression analysis of the acute phase response in channel catfish (Ictalurus punctatus) after infection with a Gram-negative bacterium. Dev Comp Immunol. 2007; 31: 1183–1196.
  16. Tong Z, Li L, Pawar R, Zhang S. Vitellogenin is an acute phase protein with bacterial-binding and inhibiting activities. Immunobiology. 2010; 215: 898-902.
  17. Shi X, Zhang S, Pang Q. Vitellogenin is a novel player in defense reactions. Fish Shellfish Immunol. 2006; 20: 769-772.
  18. Esteban MA, Meseguer J. Phagocytic defence mechanism in sea bass (Dicentrarchus labrax L.): an ultrastructural study. Anat Rec. 1994; 240: 589-597.
  19. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001; 25: 402-408.
  20. Esteban MA. An Overview of the immunological defenses in fish skin. ISRN Immunology. 2012; 1–29.
  21. Lü A, Hu X, Xue J, Zhu J, Wang Y, Zhou G. Gene expression profiling in the skin of zebrafish infected with Citrobacter freundii. Fish Shellfish Immunol. 2012; 32: 273-283.
  22. Valero Y, Chaves-Pozo E, Meseguer J, Esteban MA, Cuesta A. Biological role of fish antimicrobial peptides. Antimicrobial Peptides. 2013; 2: 31-60.
  23. Datta S, Saha DR, Ghosh D, Majumdar T, Bhattacharya S, Mazumder S. Sub-lethal concentration of arsenic interferes with the proliferation of hepatocytes and induces in vivo apoptosis in Clarias batrachus L. Comp Biochem Physiol C Toxicol Pharmacol. 2007; 145: 339-349.
  24. Tait SW, Green DR. Mitochondria and cell death: outer membrane permeabilization and beyond. Nat Rev Mol Cell Biol. 2010; 11: 621-632.
  25. Audunsdottir SS, Magnadottir B, Gisladottir B, Jonsson ZO, Bragason BT. The acute phase response of cod (Gadus morhua L.): expression of immune response genes. Fish Shellfish Immunol. 2012; 32: 360–367.
  26. Liu H, Takano T, Abernathy J, Wang S, Sha Z, Jiang Y. Structure and expression of transferrin gene of channel catfish, Ictalurus punctatus. Fish Shellfish Immunol. 2010; 28: 159-166.
  27. Gitlin JD. Transcriptional regulation of ceruloplasmin gene expression during inflammation. J Biol Chem. 1988; 263: 6281-6287.
  28. Liu H, Peatman E, Wang W, Abernathy J, Liu S, Kucuktas H. Molecular responses of ceruloplasmin to Edwardsiella ictaluri infection and iron overload in channel catfish (Ictalurus punctatus). Fish Shellfish Immunol. 2011; 30: 992-997.
  29. Cuesta A, Meseguer J, Esteban MA. The antimicrobial peptide hepcidin exerts an important role in the innate immunity against bacteria in the bony fish gilthead seabream. Mol Immunol. 2008; 45: 2333-2342.
  30. Cuesta A, Meseguer J, Esteban MÁ. Molecular and functional characterization of the gilthead seabream β-defensin demonstrate its chemotactic and antimicrobial activity. Mol Immunol. 2011; 48: 1432-1438.
  31. Bergsson, G. Antimicrobial polypeptides and lipids as a part of innate defense mechanism of fish and human fetus. 2005.
  32. Hsiao PJ, Jao JC, Tsai JL, Chang WT, Jeng KS, Kuo KK. Inorganic arsenic trioxide induces gap junction loss in association with the downregulation of connexin43 and E-cadherin in rat hepatic "stem-like" cells. Kaohsiung J Med Sci. 2014; 30: 57-67.
  33. Creagh EM, Conroy H, Martin SJ. Caspase-activation pathways in apoptosis and immunity. Immunol Rev. 2003; 193: 10-21.
  34. Banerjee C, Goswami R, Datta S, Rajagopal R, Mazumder S. Arsenic-induced alteration in intracellular calcium homeostasis induces head kidney macrophage apoptosis involving the activation of calpain-2 and ERK in Clarias batrachus. Toxicol App Pharm. 2011; 256: 44–51.
  35. Gao D, Xu Z, Qiao P, Liu S, Zhang L, He P. Cadmium induces liver cell apoptosis through caspase-3A activation in purse red common carp (Cyprinus carpio). PLoS One. 2013; 8: e83423.
  36. Sugimoto M, Uchida N, Hatayama M. Apoptosis in skin pigment cells of the medaka, Oryzias latipes (Teleostei), during long-term chromatic adaptation: the role of sympathetic innervation. Cell Tissue Res. 2000; 301: 205-216.

 

Cordero H, Guardiola FA, Cuesta A, Meseguer J, Esteban MA (2014) Arsenic Induced Inflammation and Apoptosis in Liver, Head-Kidney and Skin of Gilthead Seabream (Sparus aurata). Ann Mar Biol Res 1(1): 1001.

Received : 31 Oct 2014
Accepted : 09 Nov 2014
Published : 11 Nov 2014
Journals
Annals of Otolaryngology and Rhinology
ISSN : 2379-948X
Launched : 2014
JSM Schizophrenia
Launched : 2016
Journal of Nausea
Launched : 2020
JSM Internal Medicine
Launched : 2016
JSM Hepatitis
Launched : 2016
JSM Oro Facial Surgeries
ISSN : 2578-3211
Launched : 2016
Journal of Human Nutrition and Food Science
ISSN : 2333-6706
Launched : 2013
JSM Regenerative Medicine and Bioengineering
ISSN : 2379-0490
Launched : 2013
JSM Spine
ISSN : 2578-3181
Launched : 2016
Archives of Palliative Care
ISSN : 2573-1165
Launched : 2016
JSM Nutritional Disorders
ISSN : 2578-3203
Launched : 2017
Annals of Neurodegenerative Disorders
ISSN : 2476-2032
Launched : 2016
Journal of Fever
ISSN : 2641-7782
Launched : 2017
JSM Bone Marrow Research
ISSN : 2578-3351
Launched : 2016
JSM Mathematics and Statistics
ISSN : 2578-3173
Launched : 2014
Journal of Autoimmunity and Research
ISSN : 2573-1173
Launched : 2014
JSM Arthritis
ISSN : 2475-9155
Launched : 2016
JSM Head and Neck Cancer-Cases and Reviews
ISSN : 2573-1610
Launched : 2016
JSM General Surgery Cases and Images
ISSN : 2573-1564
Launched : 2016
JSM Anatomy and Physiology
ISSN : 2573-1262
Launched : 2016
JSM Dental Surgery
ISSN : 2573-1548
Launched : 2016
Annals of Emergency Surgery
ISSN : 2573-1017
Launched : 2016
Annals of Mens Health and Wellness
ISSN : 2641-7707
Launched : 2017
Journal of Preventive Medicine and Health Care
ISSN : 2576-0084
Launched : 2018
Journal of Chronic Diseases and Management
ISSN : 2573-1300
Launched : 2016
Annals of Vaccines and Immunization
ISSN : 2378-9379
Launched : 2014
JSM Heart Surgery Cases and Images
ISSN : 2578-3157
Launched : 2016
Annals of Reproductive Medicine and Treatment
ISSN : 2573-1092
Launched : 2016
JSM Brain Science
ISSN : 2573-1289
Launched : 2016
JSM Biomarkers
ISSN : 2578-3815
Launched : 2014
JSM Biology
ISSN : 2475-9392
Launched : 2016
Archives of Stem Cell and Research
ISSN : 2578-3580
Launched : 2014
Annals of Clinical and Medical Microbiology
ISSN : 2578-3629
Launched : 2014
JSM Pediatric Surgery
ISSN : 2578-3149
Launched : 2017
Journal of Memory Disorder and Rehabilitation
ISSN : 2578-319X
Launched : 2016
JSM Tropical Medicine and Research
ISSN : 2578-3165
Launched : 2016
JSM Head and Face Medicine
ISSN : 2578-3793
Launched : 2016
JSM Cardiothoracic Surgery
ISSN : 2573-1297
Launched : 2016
JSM Bone and Joint Diseases
ISSN : 2578-3351
Launched : 2017
JSM Bioavailability and Bioequivalence
ISSN : 2641-7812
Launched : 2017
JSM Atherosclerosis
ISSN : 2573-1270
Launched : 2016
Journal of Genitourinary Disorders
ISSN : 2641-7790
Launched : 2017
Journal of Fractures and Sprains
ISSN : 2578-3831
Launched : 2016
Journal of Autism and Epilepsy
ISSN : 2641-7774
Launched : 2016
JSM Health Education & Primary Health Care
ISSN : 2578-3777
Launched : 2016
JSM Communication Disorders
ISSN : 2578-3807
Launched : 2016
Annals of Musculoskeletal Disorders
ISSN : 2578-3599
Launched : 2016
Annals of Virology and Research
ISSN : 2573-1122
Launched : 2014
JSM Renal Medicine
ISSN : 2573-1637
Launched : 2016
Journal of Muscle Health
ISSN : 2578-3823
Launched : 2016
JSM Genetics and Genomics
ISSN : 2334-1823
Launched : 2013
JSM Anxiety and Depression
ISSN : 2475-9139
Launched : 2016
Clinical Journal of Heart Diseases
ISSN : 2641-7766
Launched : 2016
Annals of Medicinal Chemistry and Research
ISSN : 2378-9336
Launched : 2014
JSM Pain and Management
ISSN : 2578-3378
Launched : 2016
JSM Women's Health
ISSN : 2578-3696
Launched : 2016
Clinical Research in HIV or AIDS
ISSN : 2374-0094
Launched : 2013
Journal of Endocrinology, Diabetes and Obesity
ISSN : 2333-6692
Launched : 2013
Journal of Substance Abuse and Alcoholism
ISSN : 2373-9363
Launched : 2013
JSM Neurosurgery and Spine
ISSN : 2373-9479
Launched : 2013
Journal of Liver and Clinical Research
ISSN : 2379-0830
Launched : 2014
Journal of Drug Design and Research
ISSN : 2379-089X
Launched : 2014
JSM Clinical Oncology and Research
ISSN : 2373-938X
Launched : 2013
JSM Bioinformatics, Genomics and Proteomics
ISSN : 2576-1102
Launched : 2014
JSM Chemistry
ISSN : 2334-1831
Launched : 2013
Journal of Trauma and Care
ISSN : 2573-1246
Launched : 2014
JSM Surgical Oncology and Research
ISSN : 2578-3688
Launched : 2016
Annals of Food Processing and Preservation
ISSN : 2573-1033
Launched : 2016
Journal of Radiology and Radiation Therapy
ISSN : 2333-7095
Launched : 2013
JSM Physical Medicine and Rehabilitation
ISSN : 2578-3572
Launched : 2016
Annals of Clinical Pathology
ISSN : 2373-9282
Launched : 2013
Annals of Cardiovascular Diseases
ISSN : 2641-7731
Launched : 2016
Journal of Behavior
ISSN : 2576-0076
Launched : 2016
Annals of Clinical and Experimental Metabolism
ISSN : 2572-2492
Launched : 2016
Clinical Research in Infectious Diseases
ISSN : 2379-0636
Launched : 2013
JSM Microbiology
ISSN : 2333-6455
Launched : 2013
Journal of Urology and Research
ISSN : 2379-951X
Launched : 2014
Journal of Family Medicine and Community Health
ISSN : 2379-0547
Launched : 2013
Annals of Pregnancy and Care
ISSN : 2578-336X
Launched : 2017
JSM Cell and Developmental Biology
ISSN : 2379-061X
Launched : 2013
Annals of Aquaculture and Research
ISSN : 2379-0881
Launched : 2014
Clinical Research in Pulmonology
ISSN : 2333-6625
Launched : 2013
Journal of Immunology and Clinical Research
ISSN : 2333-6714
Launched : 2013
Annals of Forensic Research and Analysis
ISSN : 2378-9476
Launched : 2014
JSM Biochemistry and Molecular Biology
ISSN : 2333-7109
Launched : 2013
Annals of Breast Cancer Research
ISSN : 2641-7685
Launched : 2016
Annals of Gerontology and Geriatric Research
ISSN : 2378-9409
Launched : 2014
Journal of Sleep Medicine and Disorders
ISSN : 2379-0822
Launched : 2014
JSM Burns and Trauma
ISSN : 2475-9406
Launched : 2016
Chemical Engineering and Process Techniques
ISSN : 2333-6633
Launched : 2013
Annals of Clinical Cytology and Pathology
ISSN : 2475-9430
Launched : 2014
JSM Allergy and Asthma
ISSN : 2573-1254
Launched : 2016
Journal of Neurological Disorders and Stroke
ISSN : 2334-2307
Launched : 2013
Annals of Sports Medicine and Research
ISSN : 2379-0571
Launched : 2014
JSM Sexual Medicine
ISSN : 2578-3718
Launched : 2016
Annals of Vascular Medicine and Research
ISSN : 2378-9344
Launched : 2014
JSM Biotechnology and Biomedical Engineering
ISSN : 2333-7117
Launched : 2013
Journal of Hematology and Transfusion
ISSN : 2333-6684
Launched : 2013
JSM Environmental Science and Ecology
ISSN : 2333-7141
Launched : 2013
Journal of Cardiology and Clinical Research
ISSN : 2333-6676
Launched : 2013
JSM Nanotechnology and Nanomedicine
ISSN : 2334-1815
Launched : 2013
Journal of Ear, Nose and Throat Disorders
ISSN : 2475-9473
Launched : 2016
JSM Ophthalmology
ISSN : 2333-6447
Launched : 2013
Journal of Pharmacology and Clinical Toxicology
ISSN : 2333-7079
Launched : 2013
Annals of Psychiatry and Mental Health
ISSN : 2374-0124
Launched : 2013
Medical Journal of Obstetrics and Gynecology
ISSN : 2333-6439
Launched : 2013
Annals of Pediatrics and Child Health
ISSN : 2373-9312
Launched : 2013
JSM Clinical Pharmaceutics
ISSN : 2379-9498
Launched : 2014
JSM Foot and Ankle
ISSN : 2475-9112
Launched : 2016
JSM Alzheimer's Disease and Related Dementia
ISSN : 2378-9565
Launched : 2014
Journal of Addiction Medicine and Therapy
ISSN : 2333-665X
Launched : 2013
Journal of Veterinary Medicine and Research
ISSN : 2378-931X
Launched : 2013
Annals of Public Health and Research
ISSN : 2378-9328
Launched : 2014
Annals of Orthopedics and Rheumatology
ISSN : 2373-9290
Launched : 2013
Journal of Clinical Nephrology and Research
ISSN : 2379-0652
Launched : 2014
Annals of Community Medicine and Practice
ISSN : 2475-9465
Launched : 2014
Annals of Biometrics and Biostatistics
ISSN : 2374-0116
Launched : 2013
JSM Clinical Case Reports
ISSN : 2373-9819
Launched : 2013
Journal of Cancer Biology and Research
ISSN : 2373-9436
Launched : 2013
Journal of Surgery and Transplantation Science
ISSN : 2379-0911
Launched : 2013
Journal of Dermatology and Clinical Research
ISSN : 2373-9371
Launched : 2013
JSM Gastroenterology and Hepatology
ISSN : 2373-9487
Launched : 2013
Annals of Nursing and Practice
ISSN : 2379-9501
Launched : 2014
JSM Dentistry
ISSN : 2333-7133
Launched : 2013
Author Information X