Purpose: To determine infection and proliferation of Epstein Barr virus in ARPE-19 cells and to gain a better understanding of immunological response of ARPE-19 treated with EBV strain-1 B95-8 and recombinant EBV proteins (Nuclear Antigen and p23).

Materials and methods: ARPE-19 cells were treated with recombinant EBV proteins and EBV Type I strain. The immunological reaction of these cells to viral proteins and B95- strain was observed by a Toll like receptor expression. Viral load in the infected cell harvest was estimated by real time PCR and the cytokine expression levels were measured by Multi analyte ELISA array. Cytotoxicity and apoptosis of cells were studied by immunofluorescence and FACS assay.

Results: ARPE-19 cells responded to viral and recombinant proteins by up regulated expression of TLR 7 followed by increased secretion of IL--6, IL-8, MCP-1 at a highly significant level followed by nitric oxide (NO) production via iNOS. Increase in the viral count and electron microscopic examination of mature enveloped viral particle revealed that the virus is capable of infecting and proliferating in ARPE-19 cells. Conclusion: EBV viral proteins and Type I strain are capable of inducing inflammation in ARPE via toll like receptor mediator signalling and induce necrosis and retinal cell death. These findings provides crucial information for understanding the immune mechanisms of EBV induced inflammation and cell death and help design new immune therapeutical approaches to ocular infections caused by EBV.

Janani MK, Malathi J, Rao Madhavan HN (2017) Novel Immune Regulatory Pathway Associated with Epstein Barr Virus and Recombinant EBV Protein Mediated Inflammation in Retinal Pigment Epithelium. Ann Virol Res 3(2): 1031

Epstein Barr Virus (EBV) is a human herpes virus, classified under the gamma herpes virus subfamily, prototype of the Lymphocrytptovirus genus. It infects 95% of the world population [1]. EBV is associated with cancers such as Burkitt’s lymphoma and nasopharyngeal carcinoma [2]. During recent years an increasing number of ocular disease entities have been reported to be linked to EBV infection. These entities include oculoglandular syndrome, conjunctivitis, dry eye, keratitis, uveitis, choroiditis, retinitis, papillitis and ophthalmoplegia [3]. Understanding the biology of EBV infection in human epithelial cells will provide important insights to the role of EBV infection in the pathogenesis of EBV associated ocular infections like Retinitis, Acute Retinal Necrosis. Better understanding of immunological response of Acute Retinal Epithelial Cells (ARPE-19) upon challenging with EBV is required for this. To determine the host immune response to these infections, an in vitro study on immune response to EBV infections especially ocular acute retinal necrosis which causes devastating effects such as blindness, was designed using Retinal pigment epithelial cells. The necrotic process is due to be driven by CD4+ cells, macrophages, polymorphonuclear cells, B cells, and the inflammatory cytokines TNF-α and IFN-γ [4]. In the present study we have used human retinal pigment epithelial cells (ARPE-19) as an in-vitro model to study the possible immune response mediated by EBV P23 and NA proteins in acute retinal necrosis condition. Both P23 and NA proteins were capable of inducing both pro and anti-inflammatory cytokine production and TLR mediated immune response was evident in the transcript level. We further studied TLR associated cell signalling mechanisms in retinal epithelial cells using EBV strain 1 (B 95-8 culture filterate) along with recombinant proteins of both lytic and latent stage (P23 and NA). Both P23 and NA exposure induced nitric oxide production, apoptosis, necrosis and cell death in the later stages of inflammation. ARPE19 cells retain many of the characteristics of RPE cells, including functional tight junctions and the ability to phagocytose rod outer segments [5]. This is the first time an in-vitro study is being carried out to determine the molecular mechanism by which EBV induces inflammation in the retinal epithelial cells leading to necrosis.

Ethics statement: All the experiments were performed with ARPE-19 cells (NCCS, Pune). The study was approved by the Ethics committee, Vision Research Foundation, Sankara Nethralaya, Chennai, India as per the Helsinki declaration.

Cell culture and treatments

ARPE-19(ATCC) cells maintained in Advanced DMEM F12 (Gibco, USA), 10% FCS (Hi-media, India). The cells were trypsinised and cultured on 24 well plates. The plates were incubated at 37° C with 10% CO2 . Once the cells formed a monolayer were further used for inoculated with recombinant EBV proteins and virus produced by B95-8 cell line/ EBV type A strain (NCCS Pune). B95-8 culture is filtered through0.45 um pore size filter and further centrifuged at 3000 x g for 15 minutes and the supernatant concentrated by ultra centrifugation at 25000 x g for 1.5 h at 18° C. The virus pellet was suspended in RPMI (RoswellPark Memorial Institute medium, Hi-media, India) and stored in -80° C until used. For infection the virus suspension was diluted 1:10 with RPMI. At 72 hours post treatment with recombinant proteins and virus, cells were harvested and stored at -80° C until subjected for analysis.

Recombinant epstein barr viral proteins (Abcam, UK)
The recombinant viral proteins EBNA (Nuclear antigen) and p23 (Viral Capsid Antigen) at concentration of 10ng/ml were used for study and both were free of endotoxin (0.005 EU/ml) as determined with the limulus amebocite lysate (LAL) assay.

RNA Extraction and cDNA conversion

Total RNA was extracted using Qiagen RNAse mini kit and 5µg of total RNA was used for cDNA conversion using QuantiTect Reverse Transcription Kit and oligo-dT primers (Fermentas, USA).

RT PCR for GAPDH

Reverse Transcriptase PCR on cDNA converted from the RNA extracts of challenged cells targeting GAPDH was done to check for the integrity of the cDNA. PCR cycling conditions were as follows, denaturation at 95°C for 10 minutes, followed by 35 cycles of 94°C for 1 minute, 63°C for 1 minute for GAPDH and 72°C for 1 minute, with a final extension of 72°C for 10 minutes. PCR products were loaded on a 2% agarose gel with 0.5µg/ml ethidium bromide and images were captured. The primers used for amplification were, Forward Primer: GCCAAGGTCATCCATGACAAC and Reverse Primer: GTCCACCACCCTGTTGCTGTA and the expected amplicon size was 470bp.

Real Time PCR for determining the viral load inoculated with B95-8

The artus® EBV RG PCR Kit (Qiagen) was used to determine EBV load in the infected cells by real time PCR. 10µl of the sample (viral DNA extracted from infected cells) was added to 15µl of the master mix along with 1µl of the internal control (provided in the kit). The sample tubes (DNA from B95-8 filtrate and DNA from ARPE cells infected with B95-8 culture filtrate for 72 hrs) along with the quantification Standards (QS 1-4) were subjected to real time PCR (Rotor-Gene).

Immunofluorescence staining

Cells were seeded on to 11mm coverslips in 35mm dishes,after treatment of the cells with B95-8 for 72 hrs the cells were washed with PBS, fixed with 4% paraformaldehyde for 10 minutes followed by incubation in 10% FBS+0.01% Triton X-100 in PBS for 15 minutes. The cells were then probed with primary antibody raised in mouse against Epstein Barr nuclear antigen (Santacruz biotechnology, Heidelberg, Germany) and incubated at room temperature for an hour, followed by washing and staining with FITC-conjugated rabbit anti-mouse (Dako, Denmark). The cells were counter stained with DAPI and cover slips were mounted on glass slides with mounting medium. The fluorescent micrographs were taken with a Zeiss Axiovert microscope at 20X magnification.

Real Time PCR for detection of TLRs

Real time PCR was performed using the primers mentioned in Table 1,

with the cDNA converted from RNA extracts from the treated cell harvest to determine the changes in expression of TLRs 1-10 and GAPDH compared to the cell control. The reaction mixture was prepared according to manufacturer’s instruction and the real-time PCR was carried out as follows, 95°C for 10 minutes, followed by 35 cycles of 94°C for 1 minute, 55°C for 1 minutes for all TLRs and 63°C for GAPDH and 72°C for 1 minutes, with a final extension of 72°C for 10 minutes. The cycle threshold (ct) values of the TLR’s were normalized with respect to the GAPDH ct values and fold change in gene expression for EBV strain-1, p23 and NA treated cells were calculated with respect to the cell control.

Nitric oxide measurement

The stable end product of NO, nitrite was measured by Griess reagent assay. B95-8 and recombinant protein treated cell culture supernatant were collected at the end of 72 hrs and the assay was performed as per the manufacturer’s instruction. To study the Involvement of inducible nitric oxide (iNOS) was confirmed by immunofluorescence staining.

Cytokine expression array

The cell supernatants collected after 72 hrs were subjected to TLR-induced Cytokines: Viral-induced Multi-AnalyteELISArray Kit (Qiagen) to estimate the levels of 12 anti-viral cytokines TNFα, IL-1B, IL-6, IL- 12, 17-A, IL-8, MCP-1, RANTIS, IP-10, MIG, TARC and IFNα. The experiment was performed according to the manufacturer’s instructions.

Cytotoxicity test (CCK-8)

After the treatment of cells with B95-8 and recombinant proteins NA and p23 for 72 hrs, the cell culture medium was removed and the cell viability was detected by CCK-8 kit according to manufacturer’s instructions.

Apoptosis assay for detection of apoptic nucle

The cells were grown in 11mm cover slips in either 35mm dishes or 12 well plates and treated with B95-8 and recombinant EBV proteins NA and p23 for 72 hrs. At the end of 72hrs treatment the cells were washed with PBS and fixed with 4% paraformaldehyde for 10 minutes. The apoptotic nuceli was detected by terminal deoxynucleotidyl transferase (TdT)- mediated dUTP nick end-labelling (TUNEL) assay by using a commercial kit (TACS® 2 TdT-Fluor in situ Apoptosis Detection Kit) according to the manufacturer’s protocol. In the TUNEL method, the 3’-OH ends of DNA fragments are nick-end labeled with FITC-dUTP (or dUTP-biotin and avidin-FITC); this process is mediated by terminal deoxynucleotidyl transferase (TdT). In brief, the paraformaldehyde fixed cells were rinsed with PBS for 10 minutes, followed by incubation with proteinase K for 15 minutes at room temperature. The cells were incubated with the reaction mix for 60 minutes in a humidity chamber at 37°C followed by Strep-Flour labelling. The coverslips were mounted on to a glass slide and fluorescent images were captured by Zeiss Axiovert microscope.

Detection of stages of apoptosis in treated cells

The FACS assay was performed using the FITC Annexin V Apoptosis Detection Kit II (BD Pharmingen™). The cells were grown in 6 well Tissue culture plates and treated with B95-8, p23 and NA. After 72 hrs of treatment the cells were washed with PBS. The cells were then spun at 2000rpm for 5 minutes and then resuspended in 200µl of Binding Buffer. 2.5µl of PI (Propidium Iodide) and 3µl of Annexin V were added to the cells and the cells were then incubated at 4°C for 1 hour in the dark. The cells were washed twice with 1X Binding Buffer and were then analyzed by flow cytometry.

Processing of virus infected ARPE - 19 cells for electron microscopy

After 72 hrs of virus treatment the cells were harvested and washed with PBS. The cells are pelleted by centrifugation at 30, 000g for 2hrs and the virus infected cells are fixed with 2.5% gluteraldehyde in PBS for 20 min at 4° C. The cell pellet was replaced with PBS after 4 hrs of fixation and cells are postfixed with 1% osmium tetroxide in the above buffer at 4° C for 1 hour. Cells dehydrated in a graded series of ethanol or acetone and resuspended in 100% acetone, with pelleting at 2000 RPM.Cells resuspended in a 50:50 mix of acetone: embedding medium LX112 resin mix and pelleted at 3000 RPM, and resuspend them in 100% embedding mix and infiltrated cells in embedding mix for 1 hour under vacuum at 7800 RPM for 15 min. Cells are polymerized in embedding mix at 70° C oven overnight and fixed on trimming block and ultra thin sections were taken and carried on copper grids. Grids stained with 8% aqueous uranyl acetate, and examined with Jeol Jem 1400 TEM.

EBV recombinant proteins induced morphological changes in ARPE cells

The ARPE cells were treated with EBNA, P23 and Type-A strain of the virus (B95- 8) along with cell control and incubated at 37° C for 72 hrs. The cell control showed 100% confluency (Figure 1A).

Figure 1 Cells observed under phase contrast microscope at 72 hours post treatment with recombinant proteins and EBV Type A strain - B95-8. The ARPE cells were treated with EBNA, P23 and Type I strain of the virus (B95- 8) along with cell control and incubated at 37°C for 72 hrs. 1A: The cell control showed 100% confluency. 1B,C: Morphological effects were most visible in the cells treated by NA and p23 where plaques were the cells enlarged in size, cytoplasmic blebbing and plaques were observed visible under phase contrast microscope. 1D: All treated cells enlarged in size and observed with cytoplasmic vacuoles and lost their morphology and granulated and had formed clusters and plaques observed in B95-8 fitrate infected ARPE-19 cells.

Morphological effects were most visible in the cells treated by EBNA and p23 where plaques were visible under phase contrast microscope (Figure 1B,C). Morphological changes such as plaques, in cells treated with p23 and NA signifying cellular changes induced by antigenicity of both recombinant viral proteins. All treated cells had become granulated and had formed clusters.

EBV infection and proliferation in ARPE cells

B95-8 infected retinal cells showed cytopathic changes such as enlargement of the cells, increased nuclear cytoplasmic ratio, and plaques after 72 hrs (Figure 1D). EBV RNA level increased from 8.73 copies/µl on day 0 to 28.54 copies/µl on day 3 (Figure 2A).

Figure 2A: Real time PCR for detection of Epstein Barr viral load: EBV real time PCR performed on 72 hrs treated cell culture harvest showed increase in EBV viral RNA from 8.73 copies/µl on day 0 to 28.54 copies/µl on day 3. B: Immunofluorescence staining targeting Epstein Barr nuclear antigen: Immunofluorescence staining performed on cell control and viral treated cells showed the expression of Epstein Barr Nuclear antigen in the B95-8 treated cells.

Viral NA expression was detected in B95-8 infected retinal cells by immunofluorescence (Figure 2B).

RT PCR for GAPDH

The RT PCR products were run on a gel and GAPDH product corresponding to the 470bp was detected. The presence of GAPDH bands indicates that the extracted RNA has not disintegrated (Figure 3).

Figure 3 Agarose gel electrophoretogram showing amplification of GAPDH gene in the RNA extracted from Epstein Barr recombinant proteins and type A EBV treated ARPE cells. NC: Negative control, CC: Cell control, p23: RNA extracted from p23 (10ng/ml) treated ARPE-19 cell culture harvest, NA: RNA extracted from Nuclear antigen (10ng/ml) treated ARPE-19 cell culture harvest, B95-8: RNA extracted from EBV type A strain, B95-8 culture filtrate infected Cell harvest, MW: 100bp ladder.

Involvement of toll like receptors in the innate immune response in ARPE against EBVp23 and NA proteins and B95-8

We hypothesized the involvement of toll like receptors (TLRs) in EBV p23 and NA and B95-8 mediated inflammatory response. Real Time PCR was performed to measure the gene expression and to detect the involvement of 10 TLRs in mediating inflammatory response. The up regulation and down regulation of TLR genes were calculated by performing Real Time PCR with equal amount of cDNA for control, protein and B95-8 treated samples. All the TLR Cycle Threshold (ct) values were normalized with respect to the corresponding GAPDH values and TLR gene up regulation or down regulation were calculated with respect to the untreated control cells (Figure 4).

Figure 4 EBV recombinant proteins and EBV type A strain induced toll-like receptor activation. Epstein Barr virus recombinant proteins NA, p23 and B95-8 culture filtrate induced toll-like receptor activation. ARPE-19 cells were exposed to B95-8 filtrate and 10ng/ml of NA and p23 proteins for 72 h. Real time PCR was performed to measure the TLR gene expression. Upon exposure to NA, TLR1, 3 and 7 were significantly up regulated; TLR2 and 4 were significantly down regulated (Figure 4A). During the p23 protein treatment TLR7 and TLR8 were significantly upregulated (Figure 4B). There was drastic increase in fold change cells in the cells infected with B95-8 (Figure 4C). Apart from TLR 7, TLR 8, TLR 1 and TLR 10 were also significantly upregulated in B95-8 filtrate treated cells.

Human retinal epithelial cells released cytokines upon exposure to Virus and recombinant protein

Human retinal epithelial cells were exposed to B95-8 and viral proteins for 72 hrs and ELISA array were performed to detect cytokines in the cell culture supernatant. Treatment of ARPE-19 cells with NA and p23 has caused significant over expression of IL-6, IL-8 and MCP 1 (Figure 5A).

Figure 5 Cytokines response upon exposure to Virus and recombinant protein. Epstein Barr virus NA and p23-induced cytokine production. ARPE-19 cells were exposed to 10ng/ml of NA and p23 proteins for 72 h. Enzyme-linked immunosorbent assay (ELISA array) was performed to detect cytokines in the cell culture supernatants. 5A & 5B: NA and p23 induced interleukin (IL)-6, IL-8 and MCP-1 secretion at a highly significant level and TNFα, IL-1 β, RANTIS, MIG to a significant level. B95-8 has caused increased expression of TNFα, IL-1β, IL-17A, RANTIS, IP-10, MIG and IFNα. Data are represented as mean ± standard error of the mean (SEM) over the untreated control group. *p<0.05, ** p<0.001

Infection of B95-8 has caused increased expression of MIG, IP-10, IL-1β, TNFα, RANTIS and IL-17A. IFNα was also highly secreted in the virus infected and recombinant protein treated cell culture supernatants (Figure 5B).

Cell signaling mechanism involved in TLR mediated immune response

MyD88 being an important adaptor protein involved in TLR mediated immune activation we suspected the involvement of MyD88 in EBV p23 and NA and B95-8 mediated immune response in ARPE. Immunofluorescence staining was performed for MyD88 and nuclear translocation factor-kappa B (NF-κB). Fluorescent micrographs show that MyD88 protein expression was upregulated in the p23, NA protein and B95-8 exposed cells at the 72 h time point, but the same was not detected at the 24 h time point (Figure 6A).

Figure 6A: Immunofluorescence staining for MYD88: Toll-like receptors signalled via MyD88. ARPE-19 cells were exposed to 10ng/ml of NA and p23 proteins and B95-8 filtrate for 24 h and 72 h. Immunofluorescence staining was performed for MyD88 and nuclear factor-kappa B (NF-κB). At the 72 h time point, MyD88 fluorescent intensity increased in the NA and p23 proteins and B95-8 filtrate treated cells compared to the untreated control. At the 24 h time point, the fluorescent signal for NA and p23 proteins and B95-8 filtrate treated cells was similar to that of the control cells. Scale bar=20μm. B: Immunofluorescence staining for NF-κB. ARPE-19 cells were exposed to 10ng/ml of NA and p23 proteins and B95-8 filtrate for 24 h and 72 h. Immunofluorescence staining was performed for nuclear factor-kappa B (NF-κB). At the 24 h and 72 h time points, NF-κB nuclear translocation was not observed for the NA and p23 proteins and B95-8 filtrate treated cells. Data are representative of three independent experiments. Scale bar= 50μm.

We could not detect NF-κB nuclear translocation at the 24 and 72h time points (Figure 6B).

EBV NA, P23 and B95-8 induced nitric oxide production via inducible nitric oxide synthase

Nitrite, a stable and non-volatile product of Nitric Oxide (NO) was measured in the culture supernatants exposed to virus and viral recombinant proteins at 72 hrs by using Griess’s reagent. NO production was detected at highly significant level in the culture supernatants exposed to B95-8 filtrate and significant level of NO was detected in culture supernatant in p23 and NA treated ARPE19 cells (Figure 7A).

Figure 7A: Nitric oxide (NO) production detected in treated and untreated cell culture supernatants. ARPE-19 cells were exposed to 10ng/ml of NA and p23 proteins and B95-8 filtrate for 72 h. NA, p23 protein and B95-8 filtrate exposed cells synthesized nitric oxide (NO) at 72 h. B: iNOS expression detected by immunofluorescence staining. iNOS protein fluorescent intensities were comparatively high in the NA and p23and B95-8 treated cells at 24 and 72 h. Data are representative of three independent experiments. Scale bar = 50μM

Involvement of inducible nitric oxide (iNOS) was confirmed by immuno fluorescence staining. iNOs was expressed in ARPE cells exposed to NA, p23 and B95-8 filterate (Figure 7B).

EBV NA, P23 and B95-8 mediated apoptosis and cell death in ARPE-19

TUNEL assay was performed to detect the apoptic cells at 72 hrs exposure to recombinant proteins and B95-8. Increase in apoptic cells were observed in p23 treated cells when compared with NA. Almost all the cells treated with B95-8 showed fluorescence signifying increased percentage of retinal cells apoptosis (Figure 8A).

Figure 8A: TUNNEL assay for the detection of apoptosis. The terminal deoxynucleotidyltransferase-mediated uridine 5′-triphosphate-biotin nick end labelling (TUNEL) assay was performed to detect apoptosis. ARPE-19 cells were exposed to 10ng/ml of NA and p23 proteins and B95-8 filtrate for 72 h. Cells stained positive for apoptotic nuclei during the NA and p23 treatment, and this were absent in the control cells. The number of apoptotic cells in the B95-8 treated ARPE cells was significantly higher than that in the recombinant protein treated ARPE-19 cells. Data are representative of three independent experiments. Scale bar=50μm. 8B: Percentage Viability of cells infected with NA, p23 and B958 compared to cell control. The water-soluble tetrazolium salt WST-8 [2-(2-methoxy-4-nitrophenyl)-3-(4- nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium,monosodium salt], CCK-8 assay (using cell counting kit - 8) was performed to measure cell viability. EBV recombinant proteins NA, p23 and B95-8 filtrate induced apoptosis and cell death. ARPE-19 cells were exposed to 10ng/ml of NA and p23 proteins and B95-8 filtrate for 72 h. During the NA and p23 proteins and B95-8 filtrate treatment, cell viability significantly decreased at 72 h. Data are represented as mean ± standard error of the mean (SEM) over the untreated control group *p<0.05, **p<0.01.

The cell viability was measured by Cell Counting kit (CCK-8) assay. At 72 hrs time point when compared to the untreated control group, there was significant difference in cell viability for p23 (35%) treated cells when compared to NA treated cells (41%). Cell viability was profoundly decreased in B95-8 cells (24%) when compared with cells treated with recombinant viral proteins (Figure 8B).

Flow cytometry analysis of ARPE-19 cells treated with NA, p23 and B95-8 filtrate for 72 h revealed that 8.27% of the cells underwent necrosis treated with NA (Figure 9A,B),

Figure 9 Percentage Viability of cells infected with NA, p23 and B958 compared to cell control: Flow cytometry analysis of ARPE-19 cells treated with NA, p23 and B95-8 filtrate for 72 h. Treated cells were examined for apoptotic cells using Annexin V-FITC apoptosis detection kit. LL: Both Annexin V and PI-negative cells were viable cells, LR: Annexin V-positive/PI-negative cells were in early stages of apoptosis and UR: double positive cells were in late apoptosis, whereas UL: Annexin V- negative/PI -positive cells were necrotic

while there was increase in percentage of cells (18.04%) undergone necrosis in p23 treated cells (Figure 9C) and there was a drastic increase in the percentage (88.9%) of cells treated with B95-8 filtrate in end stage of apoptosis or dead cells and 8.86% of cells underwent necrosis (Figure 9D).

Host resistance to EBV infections includes nonspecific mechanisms involving IFNs, complement, macrophages, humoral (antibody) immunity, T cell-mediated immunity (such as cytotoxic T cells (CTLs) and T helper cell activity), and cytokine release. Animal studies have suggested that activated macrophages, IFNs and to a lesser extent, natural killer cells are important in limiting initial EBV infection, whereas humoral immunity and cell-mediated immunity are important in controlling both initial and recurrent infections [6]. In this context we examined the inflammatory potential of two major EBV antigens, NA and p23 and EBV Type A strain (B95-8) in mediating inflammation and the associated innate immune response via TLR’s in ARPE cells. Morphological changes were observed in the cells treated with NA and p23. The cytopathic effects are observed in cells infected with B95-8 filtrate.

The Real Time PCR analysis for TLR expression levels in cells treated with B95-8 showed an up regulation in TLR 7. TLR 7 is commonly up regulated in response to of viral genomes [7]. Similarly in cells treated with NA and p23 also the level of TLR 7 is up regulated. Up regulation of TLRs in cells infected with the viral strain is highly significant when compared to the up regulation in cells treated with recombinant viral proteins. In our experimental condition EBV NA and p23 proteins were not found to be very specific for single TLR as there was difference in the expression patterns of multiple TLRs in both the condition followed by up regulation and down regulation of multiple TLRs. The up regulated response of TLR transcripts can be explained by the innate immune mechanisms to eradicate the pathogen by mediating the release of pro inflammatory cytokines and the down regulation of some of the TLRs could be a mechanism of immune evasion mediated by the EBV proteins [8]. This is the first ever demonstration of TLR response in retinal cells by EBV viral proteins which are found to be bifunctional as we can see the expression IL-6, which actions as anti-inflammatory along with IL-8 secretion. We could observe MyD88 signalling evidenced by IF staining at 72 hrs post treatment (Figure 6A). MyD88 being a normal adaptor protein associated with TLR signalling we could definitely appreciate the involvement of TLRs in innate immune response, without involving NF-κB in the signalling mechanism which contributed to the cytokine release and ultimately inflammation. Our results are in distinction to the common TLR signalling via NF-κB. In this particular condition there might be other transcription factors such as IRF-7, IRAK4, TRAF6 which might have involved in the TLR signalling via MyD88 in activating the pro-inflammatory cytokine genes [9]. This study shows that various TLR’s responds via MyD88 in ARPE. The cytokine expression array (ELISA) showed that IL6, IL-8 and MCP 1 are up regulated in response to recombinant viral protein treatment and viral infection when compared to cell control. IL-6 is responsible for inhibitory effects on TNF-alpha and IL-1, and activation of IL-1 and IL-10. IL-8 is responsible for chemotaxis in target cells and also induction of phagocytosis. The role of IL-8 in ocular inflammations is found to be bifunctional which is evidenced by the participation in neovascularisation and wound healing [10]. Role of IL-6 in ocular inflammation is found to be pro-inflammatory, as this cytokine was promoted virus associated corneal inflammation followed by leukocyte infiltration and along with IL-8 and MCP results in cell apoptosis [11]. Hence these TLR induced cytokines are over expressed in the cells treated with viral proteins and EBV type A strain. MIG, RANTIS, IP 10 and IL17A are significantly up regulated in cells infected with B95-8 which in turn induces IFNα. IFNα is mainly involved in innate immune response against viral infection and involved in cell adhesion, chemo attractant which can induce immune cell migration to the site of inflammation and wound healing. Hence the properties of these cytokines can be correlated with their upregulation after viral treatment followed by involvement of inducible nitric oxide (iNOS) was confirmed by immunofluorescence staining. iNOs was expressed in cells exposed to B95-8 leading to significant levels of measurement of nitric oxide.

The increase in viral load detected by real time PCR indicates that the virus proliferation was significant in the infected ARPE19 cells. Electron microscopic examination revealed that the virus is capable of infecting and proliferating in ARPE-19 cells inferred by mature enveloped viral particle at the cell membrane of infected cell and numerous mature and immature particles lying in the cytoplasm of infected ARPE - 19 cells (Figure 10).

Figure 10 Electron micrographs of Epstein Barr virus in the infected ARPE-19 cells: A and B: Single mature enveloped particle with central, dark staining nucleic acid (DNA) at the cell membrane of infected cell, C and D: Numerous mature and immature particles lying in the cytoplasm of infected ARPE-19 cells

Apoptosis is a highly programmed cell death followed by distinctive biochemical events. It is found to be the end stage in many inflammatory conditions. IL-8 and NO is known mediators of apoptosis. We tried to find out whether EBV antigenic proteins could mediate apoptosis in Retinal cells. The reduction in the percentage of viable cells detected by CCK-8 assay indicates that the cells treated with both recombinant viral proteins and virus were underwent either cell death or apoptosis. These results were further confirmed by performing FITC Annexin-V and propidium iodide staining apoptosis assay and TUNNEL assay. The cells treated with NA and p23 have undergone necrosis and 89% of cells infected with B95-8 were undergone later stage of cell death. The percentage of cell death is highest in cells infected with B95-8 followed by p23 and then NA. Based on these results we hypothesize a pathway by which EBV proliferation in retinal cells can mediate inflammation in retinal cells, which in turn, can form pathogenesis of retinal necrosis in patients with chronic EBV infection (Figure 11).

Figure 11 Schematic representation of a possible inflammatory pathway: The toll-like receptor (TLR) ligands identify NA and p23 proteins, and MyD88 transfers the signals to transcription factors, which, in turn, induce cytokine gene expression. Adult retinal epithelial cells synthesize nitric oxide (NO) via inducible nitric oxide synthase (iNOS). These stress responses induce apoptosis and cell death.

To the best of our knowledge this is the first time an in vitro study was being carried out to detect the crucial roles in ARPE signalling in response to EBV viral proteins p23 and NA; and EBV Type A strain (B95-8). These findings may provide crucial information for understanding the immune mechanisms of EBV induced inflammation and cell death in ARPE and help design new immune therapeutical approaches to ocular infections caused by EBV.

1. Leibowitz D, Kieff E. Epstein-Barr virus. In: Roizman B, Whittey RJ, Lopez D, editors. The Human Herpesviruses. Raven Press: New York. 1993; 107-172.
2. Young LS, Rickinson AB. Epstein Barr Virus: 40 Years On. Nat Rev Cancer. 2004; 4: 757-768.
3. Maeda E, Akahane M, Kiryu S, Kato N, Yoshikawa T, Hayashi N, et al. Spectrum of Epstein-Barr virus-related diseases: A pictorial review. Jpn J Radiol. 2009; 27: 4-19.
4. Khyatti M, Patel PC, Stefanescu I, Menezes J. Epstein-Barr virus (EBV) glycoprotein gp350 expressed on transfected cells resistant to natural killer cell activity serves as a target antigen for EBV-specific antibody-dependent cellular cytotoxicity. J Virol. 1991; 65: 996-1001.
5. Dunn KC, Aotaki-Keen  AE, Putkey FR, Hjelmeland  LM. ARPE-19, a human retinal pigment epithelial cell line with differentiated properties. Exp Eye Res. 1996; 62: 155-l69.
6. Taro Kawai, Shizuo Akira. The roles of TLRs, RLRs and NLRs in pathogen recognition. Int Immunol. 2009; 21: 317-337.
7. Hemmi H, Kaisho T, Takeuchi O, Sato S, Sanjo H, Hoshino K, et al. Small anti-viral compounds activate immune cells via the TLR7 MyD88-dependent signaling pathway. Nat Immunol. 2002; 3: 196-200.
8. Janssens S, Beyaert R. Role of Toll-Like Receptors in Pathogen Recognition. Clin Mcrobiol Rev. 2003; 16: 637-646.
9. Honda K, Yanai H, Mizutani T, Negishi H, Shimada N, et al. Role of a transductional-transcriptional processor complex involving MyD88 and IRF-7 in Toll-like receptor signalling. Proc Natl Acad Sci U S A. 2004; 43: 15416-15421.
10. Strieter RM, Kunkel SL, Elner VM, Martonyi CL, Koch AE, Polverini PJ, et al. Interleukin-8: a corneal factor that induces neovascularization. Am J Pathol. 1992; 14: 1279-1284.
11. Mo JS, Matsukawa A, Ohkawara S, Yoshinaga M. Role and regulation of IL-8 and MCP-1 in LPS-induced uveitis in rabbits. Exp Eye Res. 1999; 68: 333-340.
12. Fenton RR, Molesworth-Kenyon S, Oakes JE, Lausch RN. Linkage of IL-6 with neutrophil chemoattractant expression in virus-induced ocular inflammation. Invest Ophthalmol Vis Sci. 2002; 43: 737-743.
13. Kumar MV, Nagineni CN, Chin MS, Hooks JJ, Detrick B. Innate immunity in the retina: Toll-like receptor (TLR) signaling in human retinal pigment epithelial cells. J Neuroimmunol. 2004; 153: 7-15.
14. Mukherjee PK, Bazan NG. Toll–Like Receptor Expression in Oxidative Stress– Induced Human Retinal Pigment Epithelial ARPE–19 Cells: Inhibitory Response in Apoptosis. Invest Ophthalmol Vis Sci. 2005; 46: 177.