Loading

International Journal of Plant Biology & Research

Interaction of Nitrogen Fixation and Alginate Synthesis of Azotobacter vinelandii Isolated from Myanmar Mangrove

Research Article | Open Access

  • 1. Microbiology Laboratory, Department of Biotechnology Research, Kyaukse, Myanmar
  • 2. Departement of Life Sciences and Chemistry, Jacobs University Bremen, Germany
+ Show More - Show Less
Corresponding Authors
San San Yu, Microbiology Laboratory, Department of Biotechnology Research, Kyaukse, Myanmar, Tel: 95-924-01-379
Abstract

A nitrogen-fixing bacterium Azotobacter vinelandii was isolated from the mangrove rhizospheric soil of Irrawaddy Region, Myanmar. Screening and quantitative determination of the nitrogen fixation activity and alginate producing activity of the isolated strain was studied. The algD and algU gene fragments of Azotobacter vinelandii were isolated by using designated primers. A deletion was engineered in the cloned algD and algU genes by digestion with suitable restriction endonucleases and kanamycin resistance gene cartridge was inserted. The mutation was subsequently transferred to the host bacteria, Azotobacter vinelandii by biparental mating using pEX18 vector and E .coli ST 18 under pressure of kanamycin selection. Two mutant strains were developed and confirmed by PCR. The resultant two mutant strains lost their nitrogen fixation activity due to loss of their alginate producing activity were observed.

Citation

Yu SS, Ullrich M (2018) Interaction of Nitrogen Fixation and Alginate Synthesis of Azotobacter vinelandii Isolated from Myanmar Mangrove. Int J Plant Biol Res 6(2): 1088.

Keywords

•    Azotobacter vinelandii; Mangrove rhizospheric soil; 
Nitrogen fixation activity; Alginate producing activity; 
Mutation; Kanamycin resistance gene; Biparental 
mating

INTRODUCTION

The Myanmar Coast mangroves are an eco-region in Myanmar, Malaysia, and Thailand where there were once thick forests of mangroves but today most has been cleared, resulting in loss of habitat for wildlife. The mangrove flora consists of three separate regions in Myanmar: the Rakhine mangroves, Irrawaddy mangroves, and Taninthayi mangroves. Mangrove communities are recognized as highly productive ecosystems that provide large quantities of organic matter to adjacent costal water [1]. Mangroves provide a unique ecological niche for different microbes, which play various roles in nutrient recycling as well as in various environmental activities. The highly productive and diverse microbial community living associated with mangrove ecosystems continuously transforms nutrients from dead mangrove material into sources of nitrogen, phosphorous and other nutrients. Those can be used by the plants and in turn plant-root exudates serve as a food source for the microbes [2].

Nitrogen-fixing bacteria identified as members of the genera Azospirillum, Azotobacter, Rhizobium, Clostridium, Klebsiella, Vibrio and Phyllobacterium have been isolated from the rhizosphere of various mangrove species [1,3,4]. Some of the bacteria found in mangrove roots can be used as PGPB (Plant Growth Promoting Bacteria) to improve the establishment and growth of a mangrove seedling in arid coastal areas. It is possible to enhance mangrove plant growth by addition of terrestrial salttolerant plant growth promoting bacteria [2].

Azotobacter vinelandii is a gram-negative bacterium, obligate aerobe capable of fixing nitrogen and to adapt its metabolism to diverse environmental conditions. Azotobacter vinelandii forms metabolically dormant cysts after exponential growth or upon induction with specific reagents [5]. Several years ago, Azotobacter vinelandii was used as a model for biochemical, physiology and genetic studies, regarding mainly in biological nitrogen fixation studies [6]. On this regard, the reduction of N2 to ammonia (fixation of nitrogen) by nitrogenase enzyme complex is highly sensitive to oxygen, for which Azotobacter vinelandii have particular physiological mechanisms, such as a high respiration rate [7], to protect its nitrogenase enzymes from oxygen inactivation.

A mature cyst consists of a contracted cell known as the central body that is surrounded by a capsule made up of a thin laminated outer layer, called the exine, and a thicker inner layer, the intine [5]. The polysaccharide alginate is also a major component of the cyst capsule and is essential for the differentiation process, since mutations in alginate biosynthesis genes abrogate the formation of cysts resistant to desiccation [8,9].

Alginates are polysaccharides produced by Pseudomonas and Azotobacter species [10]. Most knowledge about alginate biosynthesis have been particularly well characterized in the opportunistic human pathogen Pseudomonas aeruginosa, mainly because alginate plays an important role as a virulence factor during cystic fibrosis [11]. In contrast to P. aeruginosa, A. vinelandii is a nonpathogenic bacterium, which has been used for the development of biotechnological process to produce alginate. Alginate is a linear polysaccharide composed of variable amounts of (1-4)-b-D-mannuronic acid and its C- 5-epimer a-L-guluronic acid, which has a wide range of applications such as thickener, stabilizer, gelling agent and emulsifier in food, as well as textile and pharmaceutical industries. Studies at bioreactor laboratory scale have shown the influence of dissolved oxygen tension (DOT) on alginate production [8,12,13]. In this context, alginate could play a decisive role in protecting the nitrogenase [8], due to higher DOT (20%); alginate forms a capsule on the cell surface, suggesting a possible role as an effective barrier for oxygen.

In A. vinelandii all genes involved in the biosynthesis of alginate, except algC, are clustered in the chromosome and are headed by algD, encoding a GDP-mannose dehydrogenase, an enzyme catalyzing the committed step in the biosynthesis of this polymer [14]. Transcription of algD and algC is positively controlled by the extra cytoplasmic function sigma factor algU. AlgD expression is also controlled by the two-component system GacS/GacA, which regulates secondary metabolism in many Gram-negative bacteria [15-17].

In A.vinelandii, as in Pseudomonas aeruginosa, algU is essential for alginate production and is encoded in the algUmuc ABCD operon [18,19], MucA is an inner-membrane protein that acts as an anti-algU sigma factor by directly sequestering algU and inhibiting its activity. An algU mutant of A.vinelandii was unable to synthesize alginate. In contrast, a mucA mutation increased algD and algC transcription and consequently alginate production [17,20].

The major aim of this research work is to create the deactivated gene by antibiotic mutation for studying the interaction of nitrogen-fixation and alginate producing activity of Azotobacter vinelandii isolate from mangrove rhizospheric soil.

MATERIALS AND METHODS

Bacterial strains, plasmids, and primers used

Bacterial strains, plasmids and primers used in this study were listed in Table 1,2. Escherichia coli DH5α cells were grown overnight at 37ºC on Luria-Bertani (LB) agar plates. E. coli ST18 was grown on LB agar plates containing 50 μg/ml 5-aminolevulinic acid because strain ST18 cannot grow without the presence of AVA. E. coli transformants were maintained on LB medium supplemented with the appropriate antibiotic.

Isolation and identification of nitrogen-fixing Azotobacter vinelandii strain from mangrove rhizosphere

Soil samples were collected from the rhizosphere of mangrove plants from Irrawaddy region in Myanmar. One gram of soil samples was placed into the sterile test tube. Nine milliliter of normal saline was added to the test tube and vigorous shaking was made. Then the test tube was stand for one hour for setting down all the heavy materials from the sample. 0.5 ml of the upper portion of the sample solution was taken and inoculated into the prepared Jensen’s nitrogen free liquid medium with 3% NaCl and BTB and incubated at 37ºC for 5 days (the pH of the medium was adjusted to 7 before inoculating of the sample) [21,29]. After 5 days incubation, the medium which turned green to blue was noted and this tube was selected. A loopful of the broth culture was taken from the selected tube and streaked onto the Jensen’s nitrogen free medium with 3% NaCl and BTB and incubated at 37ºC for 5 days. Then the color of the medium was observed and the appeared colony which can turn the medium to blue was chosen. To purify this strain, the selected strain was placed on nutrient agar. After checking contamination, the pure single colony was selected and streaked on the NFG (NitrogenFree Glucose Mineral Medium Glucose 10g, CaCl2 0.1g, K2 HPO4 1g, MgSO4 0.25g, NaCl 0.5g, FeSO4 0.01g, MnSO4 0.01g, Na2MoO4 5mg, DW 1L), Alg (Alginate Production Medium Sucrose 20g, (NH4 )2 SO4 0.5 g, Na2 HPO4 2g, MgSO4 0.3 g, Yeast Extract 6 g, DW 1L), MG (Mannitol 10g, L-GlutamicAcid 2g, KH2 PO4 0.5g, NaCl0.2 g, MgSO4 0.2 g, DW 1L) and BMS (Burk’s Medium Sucrose 20 g, K2 HPO4 0.8 g, KH2 PO4 0.2 g, CaSO4 0.13 g, FeCl3 1.45 mg, Na2 MoO4 0.25 mg, DW 1L) medium. The isolated strain was checked from the different medium by Gram’s staining. All the media used in this studied were sterilized at 121ºC for 20 min.

For identification of the isolated strain by 16S rRNA sequencing method, genomic DNA was prepared by boiling 1 colony at 95ºC for 10 min in 15 ml nuclease-free water. The cell lysates were centrifuged and 1 ml of the supernatant containing the genomic DNA was used to PCR amplify the 16S rRNA gene. PCR of this gene was carried out using the 16S rRNA universal primers (5’-AGAGTTTGATCCTGGCTCAG-3’ and 5’-GGTTACCTTGTTACTACGT-3’). The amplification product was sequenced on an ABI377 sequencer instrument according to the manufacturer’s recommendation (Applied Biosystems). The 16SrRNA sequence was analyzed with the ARB software [4], and the Living Tree Project database provided the reference alignment. The neighbour-joining, maximum-likelihood and maximum-parsimony methods were used to reconstruct the phylogenetic trees [21].

Screening of the nitrogen fixation activity and alginate producing activity of the isolated bacteria

The visual detection of nitrogen fixation activity of the isolated strain was observed by using nitrogen free glucose mineral medium and HGB medium (Medium for Isolation of Marine Beneficial Diazotrophs) with BTB (bromothymol blue) and adjusted to pH 7. Individual purified colony growing on the nitrogen free glucose mineral medium was taken and inoculated into NFG medium and HGB medium containing BTB. After one week incubation, changing the color of the medium was recorded [22].

For screening of the alginate producing activity of the bacteria isolate, LB medium, NFG, Alginate Producing medium and MG (Manitol-Glucose) medium were used. 25µl of the overnight growth of bacteria culture was placed on the agar medium with various concentration of copper sulphate and incubated at 37ºC. Tolerance of this metal and heavily of mucoid colony was recorded as its alginate producing activity [23,24].

Determination of alginate biomass in the culture medium

Biomass and alginate dry weight were determined by gravimetrical methods as follows: 1ml of 0.5M EDTA-sodium salt and 0.5ml of 5M NaCl were added to 25ml sample of culture broth to separate the capsular alginate. After stirring for 5min the sample was centrifuged at 10000 rpm at 20ºC for 30min to precipitate the cells. The cells were washed twice with distilled water, recentrifuged and then dried at 80° C for 24h. The supernatant was cooled and alginate was then precipitated by the addition of 3-volumes of ice cold isopropanol which was then recovered by centrifugation at 10000 rpm at 4ºC for 30min. The precipitate was dissolved in water, precipitated again, centrifuged and then finally dried at 80°C for 24h [24,25].

Detection of nitrogen fixation and nitrogenase activity The nitrogenase activity

assay was carried out according to the method of acetylene reduction. Five ml of the Azotobacter broth medium in 12 ml vials was inoculated with ~ 104 CFU/ml of each isolate and incubated for 48-120 h at 37ºC. Once visible growth was observed, each vial was sealed with rubber stopper. By means of a disposable plastic syringe, 10% of air from the head space (7 ml) was removed and an equal amount of acetylene was injected into vials. Gas samples (0.7 ml) were removed after 24 h incubation, and were assayed for ethylene production with a gas chromatograph in triplicate (GOW MAC - GM 816 model). The chromatograph was fitted with Poropak N column and a H2 -FID detector. The rate of nitrogen fixation was calculated by Ravikumar formula [26], and values were obtained nmoles C2 H4 h−1 vial−1 [27].

Correlation of bacterial growth, alginate production and nitrogenase activity

Time-coursed quantitative measurements were carried out in Erlenmeyer flasks containing 25 ml of broth medium. 100μl of bacterial suspension were inoculated into medium and incubated at 37ºC and 180 rpm. Final population of bacterial suspension was ~104 CFUml-1. The un-inoculated medium used as control in each case. Sampling was carried out within 120 h. For estimation of the growth rate, 100μl of culture medium were removed every 12 hours, serial dilution were prepared and were contained colonies on solid medium and the growth curve was drawn, while the measurement of simultaneous alginate production and nitrogenase activity were done at 48h, 72h, 96h and 120h.

Isolation of algD and algU gene fragments from Azotobacter vinelandii isolate

According to the published sequences of algD and algU of Azotobacter vinelandii in the GenBank, 1.3-kb sequence encodes a GDP-mannose dehydrogenase and 2.5kb encodes nadBalgUmucA operon. The respective primers were designed to amplify for algD and algU from chromosomal DNA of Azotobacter vinelandii isolate.

The algD and algU gene sequence encoding GDP-mannose dehydrogenase and algUmucABCD operon were amplified by PCR. The primers algD-Fwd (ATGCGTATCATTTTCGG) and algD-Rev (TTACCAGCAGATGCCTTCTG) used to amplify the algD gene and algU-Fwd (ATCGACTGCGTGTATCTG) and algURev (CGCTCTGGTTATAGAGAC) used to amplify the algU gene of isolated strain was designed using the algD and algU gene sequence from a genomic library of Azotobacter vinelandii. The PCR was carried out for both algD and algU gene, in a final volume of 50 µl containing 1 pmol of each forward and reverse primer, 1X ThermoPol reaction buffer (New England BioLabs), 0.2 mM dNTPs (Thermo scientific), 1.25 U Vent DNA polymerase (New England BioLabs) and DNA template (obtained via colony PCR). The thermal programme consisted of 3 min at 94ºC for initial denaturation, 32 cycles of 30 s at 94ºC for denaturation, 1.5 min at 60ºC for annealing and 45 s at 72ºC for extension; 7 min at 72ºC was used for a final extension.

Generation of Azotobacter vinelandii mutant

Genetic accessibility was tested by transformation of bacterial strains using electroporation [28-30], heat shock transformation and conjugation, respectively. In this research work, pGEM-T Easy vector and pEX-18 Ap vector were used. To develop algU gene mutant and algD gene mutant, each of two gene fragments was cloned separately into E.coli DH5α with the help of PGEM-T Easy vetor (Thermo Fisher Scientific). A 1.2-kb Kanamycin resistance cassette (KmR) was excised from pFKM [31], and cloned in pGEM-T easy vector with the help of a SmaI treatment resulting in an insert fragment of 2.7-kb. Finally, the 2.7-kb fragment was cloned in vector pEX18Ap [32], following a HindIII treatment. The resulting mutagenic construct was designated pEX.Km.algD and pEX.Km.algU. To obtain Azotobacter vineladii mutants, E. coli ST18 was heat shock transformed with pEX.Km.algD and pEX. Km.algU respectively and later used for biparental conjugation with Azotobacter vineladii S-3.

Biparental conjugation was prepared by growing Azotobacter vinelandii for two days at 37ºC on BMS agar plates and resuspended into 1ml 10mM MgSO4 . E. coli ST18 Ap containing the mutagenic construct was grown overnight at 37ºC on LB agar plates supplemented with 50 μgml-1 5-aminolevulinic acid (LB.AVA) and 25 μgml-1 Km. Bacterial cells were scratched from the plate’s thereby taking double amount of isolated strain as compared to strain ST18, resuspended in LB liquid media, and mixed with each other. The mixture was spotted on BMS plus 30% LB.AVA agar plates and incubated overnight at 37ºC. After this mating period cells were scratched from plates, resuspended in MG media for 15 min. The cell suspension was serially diluted and dilutions plated on MG agar supplemented with 25 μgml-1 Km [32]. Since strain ST18 cannot grow without the presence of AVA, only Azotobacter vineladii transformants containing the KmR from the mutagenic construct transferred by homologous recombination to the bacterial genome will be capable of growing on these agar plates.

RESULTS AND DISCUSSION

Isolation and Identification of nitrogen-fixing Azotobacter vinelandii strain from mangrove rhizosphere

For the isolation of Azotobacter vinelandii from the mangrove rhizospheric soil, Jensen’s nitrogen free liquid medium with 3%NaCl and BTB was prepared. In this case 3% NaCl was used because seawater has salinity between 3.1% and 3.8% and BTB was used as a pH indicator. Most of nitrogen fixing bacteria is mucoid so the contaminated bacteria can associate with them. To purify this strain, the selected strain was placed on nutrient agar. If other bacteria associated with this strain we can clearly see that different colonies on nutrient agar. Among 7 isolated bacteria which can turn the nitrogen free medium into blue, one isolate was chosen to study in this research work due to the alignment of the sequenced amplicon showed 99% identity to the 16S gene of Azotobater vinelandii. The phylogenetic relationship of S-3 isolate (Accession Number MH048906) and related taxa was shown in (Figure1) as neighbor-joining 16S rRNA gene sequence tree.

Screening of the nitrogen fixation activity and alginate producing activity of the isolated bacteria

Nitrogen fixation activity was observed by using nitrogen free glucose mineral medium and HGB solid and liquid medium supplemented with BTB. After 3 to 5 days incubation, the medium which turned green to blue was noted because it can be assumed that bacteria can fix nitrogen for their growth so the pH of the medium higher than 7.

One function of exopolysaccharides is to protect bacteria from toxic substances. Therefore alginate producing activity of the isolated strain was observed by using various concentration of heavy metal such as copper sulphate as inducer. In this study, LB medium, NFG, Alginate Producing medium and MG (MannitolGlucose) medium were used. From the screening method, this strain did not show clearly differences on different media. Then MG (Mannitol-Glucose) medium was selected to study alginate producing activity with various concentration of copper sulphate. On this medium, 0.25 mM, 0.5 mM, 1 mM, 2 mM and 3 mM of the concentration of the copper sulphate was used. The colony from the medium with 0.25 mM copper sulphate showed heavy growth and more mucoid than other 0.5 mM and 1 mM copper sulphate as well as the colony from the MG medium only after one week incubation. No growth was found on the medium with 2 mM and 3 mM copper sulphate (Figure 2).

Correlation of bacterial growth, alginate production and nitrogenase activity

The correlation of bacteria growth, alginate production and nitrogenase activity of A.vinelandii S-3 was studied (Table 3). This phenomenon provides that the increase in nitrogen fixation dependent on alginate production and the population of bacterial growth because the number of bacteria counts increase, the alginate amount increase and the nitrogenase activity increase as well. Of several methods available for measuring nitrogen fixation, the Acetylene Reduction Assay (ARA) is simpler and faster than the other methods [33]. The results obtained in this research are in agreement with the Rodelas et al. [34], who reported 9.70 to 257.73 nmol C2 H4 h−1 vial−1 for ARA rate of A. vinelandii.

Clementi et al. [24], assessed the minimum alginate concentration 0.1-0.5 gml-1 and speculated that gravimetric method lacks sensitivity because of precipitation of salts and peptones. In a similar study, Sabra et al. [34], reported 0.2-0.9 gL-1 for alginate production by gravimetrical method. Fuminori et al. [34], stated that the sucrose-grown cells obtained at the stationary phase produced alginate at 0.3-0.4 gL-1. We obtained alginate production between 0.58-1.12 gL-1 by the same method.

Isolation of algD and algU gene fragments from Azotobacter vinelandii S-3 isolate

Genetic Marker of Antibiotic Resistance for the isolated bacteria was tested with the following antibiotics by the agar diffusion assay [35]: ampicillin (50 mg/ml), tetracycline (25 mg/ml), gentamicin (2 mg/ml), chloramphenicol (25 mg/ ml), streptomycin (25 mg/ml), carbenicillin (25 mg/ml) and kanamycin (25 mg/ml). Antibiotic stock solution was prepared as 1ml of the stock solution for 1L of nitrogen free glucose medium. The isolated strain Azotobacter vineladii was resistant to chloramphenicol and sensitive to all other antibiotics. The two gene fragments algD and algU were isolated from Azotobacter vinelandii by using the designated primers. In this case, the primers for algU were designed using the algU gene sequence of Azotobacter vinelandii DJ. Although the algU sequence of Azotobacter vinelandii DJ strain contains transposase that is 954-bp, the isolate in this research does not contain transposase, so the resulted band did not show the actual size. If we choose the primers within the base pair of 1.5-kb, normally the size will show at 1.5-kb, but our strain showed at 546-bp (1500-bp minus 954-bp) as the algU gene of our strain doesn’t contain transposase gene. If we designed primers for algU using only the gene sequence of algU of Azotobacter vinelandii DJ, the sequence was not long enough for cloning. So the primers for algU were designed by using nadB, algU and mucA (2.5Kb). The resultant algU gene sequence was 1.6-kb.

After PCR amplification, the isolated gene fragments were checked by electrophoresis and all the two gene fragments showed the correct sites compared with the Gene Ruler DNA Ladder Mix at 1.3-kb for algD and 1.6-kb for algU (Figure 3).

Then each of two gene fragments was cloned into E.coli DH 5α with the help of pGEM-T Easy vector. The successful cloning was checked by taking ten colonies from the LB agar supplemented with chloramphenicol (Azotobacter vinelandii isolate is resistant to chloramphenicol) and ampicillin (pGEM-T Easy contains Ampicillin resistance gene); the plasmid from the recombinant E.coli DH5α was extracted by plasmid extraction kit. Then the inserted gene fragment was cut out from the plasmid with restriction enzyme EcoRI. The colony which showed the correct gene fragment site was noted and kept at minus 80ºC deep freezer. For algD, nine colonies showed the correct insert at 1.3- kb for algD and 3.0-kb for pGEM-T easy vector and for algU, five colonies showed correct insert at 1.6-kb for algU and 3.0-kb for pGEM-T easy vector (Figure 4).

Generation of Azotobacter vinelandii mutant

Mutagenic construct was made by insertion the Km cassette into each of the algD and algU gene fragments which were cloned into pGEM T Easy vector (Figure 5). Then the vector containing the mutagenic construct was transferred to pEX-18 Ap sucide vector and the cloning vector was transformed to Ecoli ST18. After that the homologous recombination was done Azotobacter vinelandii isolate with recombinant E.coli ST18 which have sucide vector containing mutagenic construct. To confirm the mutant strain of Azotobacter vinelandii, algD and algU were isolated from the mutagenized strain by using the designed primers of algD and algU. The resulting gene fragments showed 2.5-kb for algD in the place of 1.3-kb and 2.8-kb for algU in the place of 1.6-kb because of the two gene fragments carrying Km cartridge, 1.2-kb (Figure 6A) compared with the Gene Ruler 1-Kb DNA ladder. The physical characteristic of the mutagenized strain changed into non-mucoid strain because it might be loss of its alginate producing activity (Figure 6B). The result obtained in this research was consistent with Fuminori et al. [35],who presented that it was easy to select alginate-overproducing mutants because these mutants seemed to form high mucoid colonies.

After biparental mating, the two mutant strains, algD negative mutant and algU negative mutant showed very slow growth on BMS medium with loss of mucoid. It can be assumed that these two mutant strains have lesser nitrogen fixation activity than the wild type strain. The two mutant strains can grow on MG medium supplemented with kanamycin. The physical appearance of Azotobacter vinelandii mutant strains was quite different from the wild type strain and no mucoid was found. The nitrogenase activity and alginate producing activity of two mutant strains were detected after four days incubation because the highest bacterial count, nitrogen fixing amount and alginate amount of wild type observed after four days incubation. Even though the two mutants strain could grow very slowly on the nitrogen free medium, none of the nitrogenase amount and alginate amount was detected. Therefore it was observed that the loss of the alginate production activity caused the loss of the nitrogen fixation activity.

CONCLUSION

Azotobacter vinelandii was isolated from the mangrove rhizospheric soil of Irrawaddy region, Myanmar. Two desired mutagenic constructs were made. pEX-18 carrying mutagenic constructs could not be transformed into Azotobacter vinelandii S-3 isolate by electroporation but two mutagenic constructs could be transformed by conjugation. Mutants were confirmed by PCR. Based on results it was found that the nitrogen fixation activity depends on the alginate producing activity.

ACKNOWLEDGEMENTS

This research work was granted by Alexander von Humboldt foundation from Germany.

REFERENCES

1. Holguin G, Vazquez P, Bashan Y. The role of sediment microorganisms in the productivity, conservation, and rehabilitation of the mangrove ecosystems: an overview. Biol Fertil Soils. 2001; 33: 265-278.

2. Sahoo K, Dhal NK. Potential microbial diversity in mangrove ecosystem: A review. Indian J Mar Sci. 2009; 38: 249-256.

3. Sengupta A, Chaudhuri S. Ecology of heterotrophic dinitrogen fixation in the rhizosphere of mangrove plant community at Ganges river estuary in India. Oecologia. 1991; 87: 560-564.

4. Ludwig W, Strunk O, Westram R, Richter L, Meier H, Yadhukumar, et al. ARB: a software environment for sequence data. Nucleic Acids Res. 2004; 32: 1363-1371.

5. Sadoff HL. Encystment and germination in Azotobacter vineladii. Bacteriol Rev. 1975; 39: 516-539.

6. Dixon R, Kahn D. Genetic regulation of biological nitrogen fixation. Nat Rev Microbiol. 2004; 2: 621-631.

7. Post E, Kleiner D, Oelze J. Whole cell respiration and nitrogenase activities in Azotobacter vinelandii growing in oxygen controlled continuous culture. Arch Microbiol. 1983; 134: 68-72.

8. Compos M, Martinez-Salazar JM, Lloret L, Moreno S, Nunez C, Espin G, et al. Characterization of the gene coding for GDP-mannose dehydrogenase (algD) from Azotobacter vinelandii. J Bacteriol. 1996; 178: 1793-1799.

9. Lin LP, Sadoff HL. Encystment and polymer production by Azotobacter vineladii in the presence of beta-hydroxybutyrate. J Bacteriol. 1968; 95: 2336-2343.

10. Remminghorst U, Rehm B. Bacterial alginates: from biosynthesis to applications. Biotechnol Lett. 2006; 28: 1701-1712.

11. Ramsey DM, Wozniak DJ. Understanding the control of Pseudomonas aeruginosa alginate synthesis and the prospects for management of chronic infections in cystic fibrosis. Mol Microbiol. 2005; 56: 309-322.

12. Peña C, Trujillo-Roldán M, Galindo E. Influence of dissolved oxygen tension and agitation speed on alginate production and its molecular weight in cultures of Azotobacter vinelandii. Enzyme Microb Technol. 2000; 27: 390-398.

13. Sabra W, Zeng AP, Lunsdorf H, Deckwer WD. Effect of oxygen on formation and structure of Azotobacter vinelandii alginate and its role in protecting nitrogenase. Appl Environ Microbiol. 2000; 66: 4037- 4044.

14. Castañeda M, Guzmán J, Moreno S, Espín G. The GacS sensor kinase regulates alginate and poly-b-hydroxybutyrate production in Azotobacter vinelandii. J Bacteriol. 2000; 182: 2624-2628.

15. Castañeda M, Sánchez J, Moreno S, Núñez C, Espín G. The global regulators GacA and sigmaS form part of a cascade that controls alginate production in Azotobacter vinelandii. J Bacteriol. 2001; 183: 6787-6793.

16. Gaona G, Núñez C, Goldberg JB, Linford AS, Nájera R, Castañeda M, et al. Characterization of the Azotobacter vinelandii algC gene involved in alginate and lipopolysaccharide production. FEMS Microbiol Lett. 2004; 238: 199-206.

17. Martínez-Salazar JM, Moreno S, Nájera R, Boucher JC, Espín G, Soberón-Chávez G, et al. Characterization of the genes coding for the putative sigma factor AlgU and its regulators MucA, MucB, MucC, and MucD in Azotobacter vinelandii and evaluation of their roles in alginate biosynthesis. J Bacteriol. 1996; 178: 1800-1808.

18. Schurr MJ, Yu H, Martinez-Salazar JM, Boucher JC, Deretic V. Control of AlgU, a member of the sE-like family of stress sigma factors, by the negative regulators MucA and MucB and Pseudomonas aeruginosa conversion to mucoidy in cystic fibrosis. J Bacteriol. 1996; 178: 4997- 5004.

19. Núñez C, León R, Guzmán J, Espín G, Soberón-Chávez G. Role of Azotobacter vinelandii mucA and mucC gene products in alginate production. J Bacteriol. 2000; 182: 6550-6556.

20. Holguin G, Guzman MA, Bashan Y. Two new nitrogen fixing bacteria from the rhizosphere of mangrove trees: their isolation, identification and in vitro interaction with rhizosphere Staphylococcus sp. FEMS Microbiol Ecol. 1992; 101: 207-216.

21. Yarza P, Richter M, Peplies J, Euzeby J, Amann R, Schleifer KH, et al. The All-Species Living Tree project: a 16S rRNA-based phylogenetic tree of all sequenced type strains. Syst Appl Microbiol. 2008; 31: 241- 250.

22. Kenichi I, San SY, Nik NA, Toshio O. Ammonia Accumulation of Novel Nitrogen-Fixing bacteria: Molecular Studies and Novel Applications for Improved Quality of Human Life, Prof. Reda Sammour Editor. InTech. 2012.

23. Kidambi SP, Sundin GW, Palmer DA, Chakrabarty AM, Bender CL. Copper as a Signal for Alginate Synthesis in Pseudomonas syringae pv. Syringae. Appl Environ Microbiol. 1995; 61: 2172-2179.

24. Xu J, Smyth CL, Buchanan JA, Dolan A, Rooney PJ, Millar BC, et al. Employment of 16 S rDNA gene sequencing techniques to identify culturable environmental eubacteria in a tertiary referral hospital. J Hosp Infect. 2004; 57: 52-58.

25. Clementi F, Moresi M, Parente E. Alginate from Azotobacter vinelandii. In: Carbohydrate biotechnology protocols. C Bucke, NJ Totowa. Springer, Humana Press Inced, 1999; 23-42.

26. Sabra W, Zeng AP, Lunsdorf H, Deckwer WD. Effect of oxygen on formation and structure of Azotobacter vinelandii alginate and its role in protecting nitrogenase. Appl Environ Microbiol. 2000; 66: 4037- 4044.

27. Muthukumarasamy R, Revathi G, Lakshminarasimhan C. Influence of N fertilisation on the isolation of Acetobacter diazotrophicus and Herbaspirillum spp. from Indian sugarcane varieties. Biol Fertil Soils. 1999; 29: 157-164.

28. Hardy RWF, Holsten RD, Jackson EK, Burns RC. The acetylene-ethylene assay for N2 fixation: laboratory and field evaluation. Plant Physiol. 1968; 43: 1185-1207.

29. Hamashitna H, Iwasaki M, Taketoshi A. A simple and rapid method for transformation of Vibrio species by electroporation. 1995; 47: 155- 160.

30. Zucol F, Ammann RA, Berger Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. New York: Cold Spring Harbor Laboratory Press. 1989; 2.

31. Wang H, Griffiths MW. Mg2+-free buffer elevates transformation efficiency of Vibrio parahaemolyticus by electroporation. Lett Appl Microbiol. 2009; 48: 349-354.

32. Thoma S, Schobert M. An improved Escherichia coli donor strain for diparental mating. FEMS Microbiol. Lett. 2009; 294: 127-132.

33. Rodelas B, Gonzalez-Lopez J, Pozo C, Salmeron V, Martinez-Toledo MV. Response of faba bean (Viciafaba L.) to combined inoculation with Azotobacter and Rhizobium leguminosarum bv.viceae. Appl Soil Ecol. 1999; 12: 51-59.

34. Fuminori Y, Mayumi Y, Wataru H, Kousaku M. Production of polyhydroxybutyrate and alginate from glycerol by Azotobacter vinelandii under nitrogen-free conditions. Bioengineered. 2015; 6: 209-217.

35. Jorgensen JH, Turnidge JD. Antibacterial susceptibility tests: dilution and disk diffusion methods. In Manual of Clinical Microbiology. American Society for Microbiology. 2007; 9: 1152-1172.

Received : 08 Feb 2018
Accepted : 22 Mar 2018
Published : 27 Mar 2018
Journals
Annals of Otolaryngology and Rhinology
ISSN : 2379-948X
Launched : 2014
JSM Schizophrenia
Launched : 2016
Journal of Nausea
Launched : 2020
JSM Internal Medicine
Launched : 2016
JSM Hepatitis
Launched : 2016
JSM Oro Facial Surgeries
ISSN : 2578-3211
Launched : 2016
Journal of Human Nutrition and Food Science
ISSN : 2333-6706
Launched : 2013
JSM Regenerative Medicine and Bioengineering
ISSN : 2379-0490
Launched : 2013
JSM Spine
ISSN : 2578-3181
Launched : 2016
Archives of Palliative Care
ISSN : 2573-1165
Launched : 2016
JSM Nutritional Disorders
ISSN : 2578-3203
Launched : 2017
Annals of Neurodegenerative Disorders
ISSN : 2476-2032
Launched : 2016
Journal of Fever
ISSN : 2641-7782
Launched : 2017
JSM Bone Marrow Research
ISSN : 2578-3351
Launched : 2016
JSM Mathematics and Statistics
ISSN : 2578-3173
Launched : 2014
Journal of Autoimmunity and Research
ISSN : 2573-1173
Launched : 2014
JSM Arthritis
ISSN : 2475-9155
Launched : 2016
JSM Head and Neck Cancer-Cases and Reviews
ISSN : 2573-1610
Launched : 2016
JSM General Surgery Cases and Images
ISSN : 2573-1564
Launched : 2016
JSM Anatomy and Physiology
ISSN : 2573-1262
Launched : 2016
JSM Dental Surgery
ISSN : 2573-1548
Launched : 2016
Annals of Emergency Surgery
ISSN : 2573-1017
Launched : 2016
Annals of Mens Health and Wellness
ISSN : 2641-7707
Launched : 2017
Journal of Preventive Medicine and Health Care
ISSN : 2576-0084
Launched : 2018
Journal of Chronic Diseases and Management
ISSN : 2573-1300
Launched : 2016
Annals of Vaccines and Immunization
ISSN : 2378-9379
Launched : 2014
JSM Heart Surgery Cases and Images
ISSN : 2578-3157
Launched : 2016
Annals of Reproductive Medicine and Treatment
ISSN : 2573-1092
Launched : 2016
JSM Brain Science
ISSN : 2573-1289
Launched : 2016
JSM Biomarkers
ISSN : 2578-3815
Launched : 2014
JSM Biology
ISSN : 2475-9392
Launched : 2016
Archives of Stem Cell and Research
ISSN : 2578-3580
Launched : 2014
Annals of Clinical and Medical Microbiology
ISSN : 2578-3629
Launched : 2014
JSM Pediatric Surgery
ISSN : 2578-3149
Launched : 2017
Journal of Memory Disorder and Rehabilitation
ISSN : 2578-319X
Launched : 2016
JSM Tropical Medicine and Research
ISSN : 2578-3165
Launched : 2016
JSM Head and Face Medicine
ISSN : 2578-3793
Launched : 2016
JSM Cardiothoracic Surgery
ISSN : 2573-1297
Launched : 2016
JSM Bone and Joint Diseases
ISSN : 2578-3351
Launched : 2017
JSM Bioavailability and Bioequivalence
ISSN : 2641-7812
Launched : 2017
JSM Atherosclerosis
ISSN : 2573-1270
Launched : 2016
Journal of Genitourinary Disorders
ISSN : 2641-7790
Launched : 2017
Journal of Fractures and Sprains
ISSN : 2578-3831
Launched : 2016
Journal of Autism and Epilepsy
ISSN : 2641-7774
Launched : 2016
Annals of Marine Biology and Research
ISSN : 2573-105X
Launched : 2014
JSM Health Education & Primary Health Care
ISSN : 2578-3777
Launched : 2016
JSM Communication Disorders
ISSN : 2578-3807
Launched : 2016
Annals of Musculoskeletal Disorders
ISSN : 2578-3599
Launched : 2016
Annals of Virology and Research
ISSN : 2573-1122
Launched : 2014
JSM Renal Medicine
ISSN : 2573-1637
Launched : 2016
Journal of Muscle Health
ISSN : 2578-3823
Launched : 2016
JSM Genetics and Genomics
ISSN : 2334-1823
Launched : 2013
JSM Anxiety and Depression
ISSN : 2475-9139
Launched : 2016
Clinical Journal of Heart Diseases
ISSN : 2641-7766
Launched : 2016
Annals of Medicinal Chemistry and Research
ISSN : 2378-9336
Launched : 2014
JSM Pain and Management
ISSN : 2578-3378
Launched : 2016
JSM Women's Health
ISSN : 2578-3696
Launched : 2016
Clinical Research in HIV or AIDS
ISSN : 2374-0094
Launched : 2013
Journal of Endocrinology, Diabetes and Obesity
ISSN : 2333-6692
Launched : 2013
Journal of Substance Abuse and Alcoholism
ISSN : 2373-9363
Launched : 2013
JSM Neurosurgery and Spine
ISSN : 2373-9479
Launched : 2013
Journal of Liver and Clinical Research
ISSN : 2379-0830
Launched : 2014
Journal of Drug Design and Research
ISSN : 2379-089X
Launched : 2014
JSM Clinical Oncology and Research
ISSN : 2373-938X
Launched : 2013
JSM Bioinformatics, Genomics and Proteomics
ISSN : 2576-1102
Launched : 2014
JSM Chemistry
ISSN : 2334-1831
Launched : 2013
Journal of Trauma and Care
ISSN : 2573-1246
Launched : 2014
JSM Surgical Oncology and Research
ISSN : 2578-3688
Launched : 2016
Annals of Food Processing and Preservation
ISSN : 2573-1033
Launched : 2016
Journal of Radiology and Radiation Therapy
ISSN : 2333-7095
Launched : 2013
JSM Physical Medicine and Rehabilitation
ISSN : 2578-3572
Launched : 2016
Annals of Clinical Pathology
ISSN : 2373-9282
Launched : 2013
Annals of Cardiovascular Diseases
ISSN : 2641-7731
Launched : 2016
Journal of Behavior
ISSN : 2576-0076
Launched : 2016
Annals of Clinical and Experimental Metabolism
ISSN : 2572-2492
Launched : 2016
Clinical Research in Infectious Diseases
ISSN : 2379-0636
Launched : 2013
JSM Microbiology
ISSN : 2333-6455
Launched : 2013
Journal of Urology and Research
ISSN : 2379-951X
Launched : 2014
Journal of Family Medicine and Community Health
ISSN : 2379-0547
Launched : 2013
Annals of Pregnancy and Care
ISSN : 2578-336X
Launched : 2017
JSM Cell and Developmental Biology
ISSN : 2379-061X
Launched : 2013
Annals of Aquaculture and Research
ISSN : 2379-0881
Launched : 2014
Clinical Research in Pulmonology
ISSN : 2333-6625
Launched : 2013
Journal of Immunology and Clinical Research
ISSN : 2333-6714
Launched : 2013
Annals of Forensic Research and Analysis
ISSN : 2378-9476
Launched : 2014
JSM Biochemistry and Molecular Biology
ISSN : 2333-7109
Launched : 2013
Annals of Breast Cancer Research
ISSN : 2641-7685
Launched : 2016
Annals of Gerontology and Geriatric Research
ISSN : 2378-9409
Launched : 2014
Journal of Sleep Medicine and Disorders
ISSN : 2379-0822
Launched : 2014
JSM Burns and Trauma
ISSN : 2475-9406
Launched : 2016
Chemical Engineering and Process Techniques
ISSN : 2333-6633
Launched : 2013
Annals of Clinical Cytology and Pathology
ISSN : 2475-9430
Launched : 2014
JSM Allergy and Asthma
ISSN : 2573-1254
Launched : 2016
Journal of Neurological Disorders and Stroke
ISSN : 2334-2307
Launched : 2013
Annals of Sports Medicine and Research
ISSN : 2379-0571
Launched : 2014
JSM Sexual Medicine
ISSN : 2578-3718
Launched : 2016
Annals of Vascular Medicine and Research
ISSN : 2378-9344
Launched : 2014
JSM Biotechnology and Biomedical Engineering
ISSN : 2333-7117
Launched : 2013
Journal of Hematology and Transfusion
ISSN : 2333-6684
Launched : 2013
JSM Environmental Science and Ecology
ISSN : 2333-7141
Launched : 2013
Journal of Cardiology and Clinical Research
ISSN : 2333-6676
Launched : 2013
JSM Nanotechnology and Nanomedicine
ISSN : 2334-1815
Launched : 2013
Journal of Ear, Nose and Throat Disorders
ISSN : 2475-9473
Launched : 2016
JSM Ophthalmology
ISSN : 2333-6447
Launched : 2013
Journal of Pharmacology and Clinical Toxicology
ISSN : 2333-7079
Launched : 2013
Annals of Psychiatry and Mental Health
ISSN : 2374-0124
Launched : 2013
Medical Journal of Obstetrics and Gynecology
ISSN : 2333-6439
Launched : 2013
Annals of Pediatrics and Child Health
ISSN : 2373-9312
Launched : 2013
JSM Clinical Pharmaceutics
ISSN : 2379-9498
Launched : 2014
JSM Foot and Ankle
ISSN : 2475-9112
Launched : 2016
JSM Alzheimer's Disease and Related Dementia
ISSN : 2378-9565
Launched : 2014
Journal of Addiction Medicine and Therapy
ISSN : 2333-665X
Launched : 2013
Journal of Veterinary Medicine and Research
ISSN : 2378-931X
Launched : 2013
Annals of Public Health and Research
ISSN : 2378-9328
Launched : 2014
Annals of Orthopedics and Rheumatology
ISSN : 2373-9290
Launched : 2013
Journal of Clinical Nephrology and Research
ISSN : 2379-0652
Launched : 2014
Annals of Community Medicine and Practice
ISSN : 2475-9465
Launched : 2014
Annals of Biometrics and Biostatistics
ISSN : 2374-0116
Launched : 2013
JSM Clinical Case Reports
ISSN : 2373-9819
Launched : 2013
Journal of Cancer Biology and Research
ISSN : 2373-9436
Launched : 2013
Journal of Surgery and Transplantation Science
ISSN : 2379-0911
Launched : 2013
Journal of Dermatology and Clinical Research
ISSN : 2373-9371
Launched : 2013
JSM Gastroenterology and Hepatology
ISSN : 2373-9487
Launched : 2013
Annals of Nursing and Practice
ISSN : 2379-9501
Launched : 2014
JSM Dentistry
ISSN : 2333-7133
Launched : 2013
Author Information X