Loading

International Journal of Rare Diseases and Orphan Drugs

RNAi Regulation Profile Comparison in SH-Sy5y and U87 Cells: Response upon ? Endorphin

Original Research | Open Access Volume 2 | Issue 2 |

  • 1. College of Medicine & Medical School, Yonsei University, Seoul, Korea
  • 2. Seoul National Univeristy Hospital Biomedical Research Insitutue, Seoul, Korea
  • 3. Korean Language Major & Pre Medicine Department of Arts and Sciences, University of Washington, USA.
  • 4. Department of Mathematics, Yonsei Univeristy, Seoul, Korea
+ Show More - Show Less
Corresponding Authors
Seung Chan Kim, College of Medicine & Medical School, Yonsei University, 50 Yonsei-ro, Seodaemungu, Seoul, 120-749, Republic of Korea Tel: +82-2-6245-2835
Abstract

Glioblastoma (GBM) is an important tumor that has prevalence in childhood over adults, whereas many other types of tumor have high incidence after adolescence. It is a rare disease in terms of epidemiology of tumor incidence by age groups. The key role of synthetic endorphin in its RNA modification level is investigated in glioblastoma and neuroblastoma cell model by micro RNA array profiling. Our findings indicate that endorphins have highly skewed transcriptome processing profile in neuroblastoma as compared to glioblastoma. Also, cell viability decreased in Glioblastoma upon beta endorphin treatment. It provides a transcriptional model for endorphin neurotransmitter effects with two human brain derived cells.

Citation

Kim S, Im W, Shulipa O, Kim B (2017) RNAi Regulation Profile Comparison in SH-Sy5y and U87 Cells: Response upon β Endorphin. Int J Rare Dis Orphan Drugs 2(2): 1008

Keywords
  • RNAi target
  • Glioblastoma
  • Endorphin
  • Neuroblastoma
  • Profile dependent indicator

 

INTRODUCTION

Endorphins belong to a group of neurotransmitters known as opioids, which are peptide like signaling molecules that bind to their receptor in the brain. The receptor functions as a G-coupled protein complex with k, u, and m subunits, and belongs to a group of heptahelical model proteins that are expressed in both the central and peripheral nervous systems. Other opioids such as enkephalins and dynorphins also bind opioid receptors [1,2].

Most of the opioid-endorphin categorical neurotransmitters are reported with sensory function and pain [3]. In case of rats, stress has shown to decrease the malignant tumor resistance mediated by the release of opioid peptides [4]. In a study on stress and its effect on malignant tumor development, it was shown that stress decreases the opioid mediated tumor resistance in rats. Previous research done by Tug McGraw Research Center reported that subjects with brain cancer tend to have high levels of psychological stress [5], whereas, Université de la Méditerranée (France) pilot research data reports that this ‘stress’ induce the higher rates of brain tumors. In the use of morphines, glioblastoma proliferation is impaired [6].

Cerebral cancer treatments, such as brain surgery and total-ectomy of partial brain tissues, has shown high disability rates in post-treatment patients. Treatment with radiotherapy or chemotherapy carries a high risk of compromising the patients’ immune system, resulting in a heightened sensitivity to nosocomial pathogens.

GBM is one of the common malignant tumors with 5 year survival rate less than 5% [7,8,9]. Malignant glioblastoma is common after age 50 with WHO standard Grade IV, which has high resistance to chemotherapy [10]. U87MGcell line is derived from these tissues have studied thoroughly to find the anticancer drug’s therapeutic effects [11,12,13,14].

Compared to the established cancer treatments, surgery and radiotherapy, pre-existing material control was intended to minimize the side effects. Especially, we applied materials that are present in the human nervous system, such as neurotransmitters. In case of endorphin, its effect on reduction of stress and increase of immunity is well known [15,16], and this endorphin requires opioid receptors [17,18].

In this study, we postulated that there will be miRNA level changes which may be underlying within the cancer inhibitory mechanisms. Endorphins naturally exist as neurotransmitters, which is naturally degraded in polypeptide form. Therefore, our study focuses on profiling miRNA interactions with endorphin as a key growth controlling factor in U87 glioblastoma and SH-Sy5y neuroblastoma cells.

MATERIALS AND METHODS

Cell culture and induction of neural process formation

SH-SY5Y, a human neuroblastoma and U87 glioblastoma cell line (ATCC, Manassas,VA, USA), were used in this study. Cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA), 100 U/mL of penicillin, 0.1 mg/mL of streptomycin (Sigma-Aldrich, St Louis, MO, USA), and L-glutamine (2 mM) in 75-cm2 tissue culture flasks (Falcon, Becton Dickinson, Lincoln Park, NY, USA) at 37o C in 5% CO2 . SH-SY5Y and U87 cells were incubated with synthetic beta endorphins at 0.1μM, 1μM and 10μM concentration. This was analyzed with WST-1 viability assay (Sigma-Aldrich). The source of the cells was Homo sapiens ‘either sex’ (male and female).

RNA isolation

Total RNA was extracted from SH-SY5Y and U87 cells treated with 1μM of endorphin for 48 hours by using Trizol (Invitrogen) using the manufacturer’s protocol. Addition of chloroform followed by centrifugation separates aqueous and organic phase. RNA was recovered by precipitation with alcohol. Starting with 1,000 ng/μL RNA as template, cDNA was synthesized by using 50 ng/μL random hexamers, 0.1 M dNTPmix, and DEPC-water at 65o C 5 min. 10 RT buffer, 25 mM MgCl, 0.1 M DTT, RNase OUT, and Superscript III RT (all from Invitrogen) were added in the final volume of 20 μL, and the reaction was incubated at 25o C for 10 min, 50o C for 50 min and 85o C for 5 min.

MicroRNA array and Transcriptome profiling.

Total RNA was isolated from cells using Trizol (Invitrogen, Carlsbad, CA, USA). The RNA purity and concentration were measurement using a NanoDrop ND-1000 Spectrophotometer (NanoDrop Tech. Rockland, DE, USA) and a Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA). Expression profiles for miRNA were examined using an Agilent Mouse miRNA Microarray 8×15 K kit, which detects 567 mouse miRNAs, according to the manufacturer's instructions (Agilent Technologies). Two RNA samples were hybridized for each group. Equal amounts of total RNA from each sample were used. Scanning and analysis were performed using an Agilent hardware platform, and the data were normalized and analyzed using GeneSpring GX, version 7.3.1 (Agilent Technologies) according to the manufacturer's instructions. Measurements less than 0.01 were set as 0.01. The total amounts of miRNAs in each sample were determined by summing the levels of each miRNA.

Statistical methods.

Student’s t-test was used to evaluate the inhibitory effect of endorphin and its significant role in dose dependent manner. ANOVA and Chi-square test were also applied to table sets in RNAi gene expression profile.

RESULTS

Viability effects of synthetic endorphin in U87 cell line

The endorphins reduced the viability of U87 GM cells. Compared to control, there was a significant decrease in proliferation after the treatment of endorphin (Fig. 1a). As the dose rose to 0.1μM, 1μM and 10μM, the p-value turned as 0.0675, 8E-05 and 4.9E-05 respective to the control group. It showed dose dependent effects while the dose was increased from 0.1μM to 1μM, but did not show significant differences between 1μM and 10μM.

Profile comparison between U87 and SH-Sy5y transcripts

Micro RNA array analysis between the effects of endorphin in U87 and SH-Sy5y cells were adverse. Out of human gene transcripts, 67 micro RNA targets showed change more than 1.5-fold in U87 or SH-Sy5y cells (Fig. 1b). In those 67 targets, 11 targets were up-regulated and 7 targets were down regulated more than 2-fold in SH-Sy5y solely (Table 1 and Table 2).

Discovered possible targets for Glioblastoma specific regulations

The hsa-miR-574-3p only showed different and opposing fold change between SH-Sy5y cells and U87 cells. It was up regulated about 2.318 fold in SH-Sy5y cells and 0.625 down regulated in U87 cells. In other words, the micro RNA down regulates the target genes in SH-Sy5y cells and up-regulates in U87 cells (Table 3). The general target genes for hsa-miR-574-3p (3'ACACCCACACACGUACUCGCAC 5’) are retinoid X receptor alpha, Kruppel-like factor 12, cullin 2 (CUL2), DAB2 interacting protein (DAB2IP), NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 4-like 2 and FOS-like antigen 2 (Table 3a). In case of cullin 2, nearly 70% of the naturally-occurring cancer-disposing mutations in VHL abrogate elongin binding, suggesting that binding to elonginCUL2 complexes contributes to the ability of VHL to suppress tumor growth in vivo. It is suggested that CUL2 is a candidate tumor suppressor gene, as has been proposed for CUL1. DAB2IP is a Ras GTPase-activating protein (GAP) that acts as a tumor suppressor. The DAB2IP gene is inactivated by methylation in prostate and breast cancers. Expression of DAB2IP was lower in prostate cancer cell lines than in normal prostate epithelial cell lines. They showed that the P1 promoter of DAB2IP was active in normal cells, but inactive in the cancer cell lines (Table 3a).

DISCUSSION

Treatment of cells with synthetic beta neurotransmitter has shown to inhibit cell proliferation as determined by cell count and WST-1 assay. In the course of human micro RNA target analysis, it has been discovered that U87 cells might have possible unique properties that are coded by the has-miR-574-3p gene sequence. The changes solely represent effect on SH-Sy5y cells as some inhibitory manners, in miR-708, miR-454, miR-375, miR-532-5p, miR 301b, miR-106b and miR-1248. The targets for miR-301b and miR-454 overlapped (Table 1). Zinc Finger protein expression was regulated, in miR-595 and miR-1260, while Zinc Finger domain is a key transcription factor for neurotransmitters (Table 2).

Opioids are known to reduce pain and it is used in some cases to reduce long-term pain that is exerted by cancer. Also, it play multiple roles in central and peripheral nervous system. Opioids influence immunity, respiration, behavior and intestine movement. However, other than its influence in pain, it is reported to regulate cell growth. Therefore, it should be carefully controlled when performing cancer therapy [1]. Also, it activates the vascular endothelial growth factor (VEGF) receptor, which worsens the status of cancer [19,20]. Thus, we postulated that internal opioids such as endorphin might affect cancer cell growth. As a result, in initial concentration of 0.1 μM, the effects were indistinguishable, but when concentration was increased in a log scale, the proliferation was decreased. Previous studies showed that some opioids such as morphine facilitated the growth of glioblastoma T98G in concentrations of 20 and 40 μM but decreased its proliferation on treatment with opioid biphalin. Biphalin is known to have 1000-fold pain reducing effect compared to morphines.

The dose-dependent response is contingent on interactions between ligands and ligand receptors. In low concentrations, these opioids act as an agonist, whereas in higher concentrations they function as antagonist. Higher concentrations alter the receptors configuration causing it to react as an antagonist. Therefore, according to our study, endorphins may be considered as antagonists to their receptors if the concentration is increased, diminishing their effect [25, 26].

In line with signal transductions that are derived from cell membrane proteins, there are several possible mechanisms for cell growth inhibition [26]. For example, although it has been reported that opioids might be able to regulate cell growth or apoptosis [1,21,22,23]. PARP1 inhibition is a possible therapeutic target in GBM [27]. However, in case of T98G glioblastoma cell membrane, opioid receptors are expressed and the expressions did not change regardless of opioid treatment. Thus, it is early to generalize that cell proliferation and apoptotic signaling might be a phenomenon related to down-regulation or desensitization by receptor internalization [24]. Several genes, such as CUL2 and DAB2IP genes are studied as markers in prostate and breast cancers, but should be verified to show a conceptual model in glioblastoma and neuroblastomas. An implication of Ras dependent signaling pathway and related tumor suppression is another issue, its limitations might also be related to synthetic endorphin binding in its opioid receptors.

In conclusion, our new finding supports that transcriptional difference underlies in the effects of endorphin, especially in neuronal origin cells. Unique mechanisms are found in certain micro RNA. Our profiles will supplement a post-transcriptional genetic base for endocrine materials, which are poorly studied for drug resistance, conditions such as placebo response, neuroprotectivity and endorphin neurotransmitter effects of human brain derived cells.

ACKNOWLEDGEMENT

We thank Dr. Jae-joon Bahn for reviewing cell line samples.

DISCLOSURE

The authors declare no competing financial interests.

REFERENCES

1. I Tegeder, G Geisslinger. Opioids as modulators of cell death and survival--unraveling mechanisms and revealing new indications. Pharmacol Rev. 2004; 56: 351-369.

2. AM Trescot, SE Glaser, H Hansen, R Benyamin, S Patel, L Manchikanti. Effectiveness of opioids in the treatment of chronic non-cancer pain. Pain Physician. 2008; 11: S181-200.

3. A Garland, JE Jordan, J Necheles, LE Alger, MM Scully, RJ Miller, DW Ray, SR White, J Solway. Hypertonicity, but not hypothermia, elicits substance P release from rat C-fiber neurons in primary culture. J Clin Invest. 1995; 95: 2359-2366.

4. Y Shavit, GW Terman, FC Martin, JW Lewis, JC Liebeskind, RP Gale. Stress, opioid peptides, the immune system, and cancer. J Immunol. 1985; 135: 834s-837s.

5. JJ Swartz, ST Keir. Program preferences to reduce stress in caregivers of patients with brain tumors. Clin J Oncol Nurs. 2007; 11: 723-727.

6. C Cabaniols, R Giorgi, O Chinot, N Ferahta, V Spinelli, P Alla, M Barrie, MP Lehucher-Michel. Links between private habits, psychological stress and brain cancer: a case-control pilot study in France. J Neurooncol. 2011; 103: 307-316.

7. GE Keles, B Anderson, MS Berger. The effect of extent of resection on time to tumor progression and survival in patients with glioblastoma multiforme of the cerebral hemisphere. Surg Neurol. 1999; 52: 371- 379.

8. L Laraqui, A Amarti, F Zouaidia, M Maher, F Kettani, A Saidi. [Pulmonary metastasis from a glioblastoma. A case report]. Rev Pneumol Clin. 2001; 57: 225-228.

9. M Lacroix, D Abi-Said, DR Fourney, ZL Gokaslan, W Shi, F DeMonte, FF Lang, IE McCutcheon, SJ Hassenbusch, E Holland, K Hess, C Michael, D Miller, R Sawaya. A multivariate analysis of 416 patients with glioblastoma multiforme: prognosis, extent of resection, and survival. J Neurosurg. 2001; 95: 190-198.

10. K Wakai, K Matsuo. The JICA training course, community-based cancer prevention for the Asian and Pan-Pacific countries, fiscal year 2006 (epidemiological approach). Asian Pac J Cancer Prev. 2007; 8: 150-154.

11. EC Wolff, MH Park. Identification of lysine350 of yeast deoxyhypusine synthase as the site of enzyme intermediate formation. Yeast. 1999; 95: 43-50.

12. JW Barrett, LR Alston, F Wang, MM Stanford, PA Gilbert, X Gao, J Jimenez, D Villeneuve, P Forsyth, G McFadden. Identification of host range mutants of myxoma virus with altered oncolytic potential in human glioma cells. J Neurovirol. 2007; 13: 549-560.

13. T Yoshida, N Kawano, H Oka, K Fujii, Y Nakazato. Clinical cure of glioblastoma--two case reports. Neurol Med Chir (Tokyo). 2000; 40 224-229.

14. N Nomura, M Nomura, EW Newcomb, D Zagzag. Geldanamycin induces G2 arrest in U87MG glioblastoma cells through downregulation of Cdc2 and cyclin B1. Biochem Pharmacol. 2007; 73: 1528-1536.

15. MD Bronstein [Use of growth hormone in normal short height children: considerations]. Rev Paul Med. 1991; 109: 189-190.

16. A Merenlender-Wagner, Y Dikshtein, G Yadid. The beta-endorphin role in stress-related psychiatric disorders. Curr Drug Targets. 2009; 10: 1096-1108.

17. LF Tseng. Evidence for epsilon-opioid receptor-mediated betaendorphin-induced analgesia. Trends Pharmacol Sci. 2001; 22: 623- 630.

18. M Narita, H Mizoguchi, H Nagase, LF Tseng. Use of antisense oligodeoxynucleotide to delta-opioid receptor mRNA in the study of turnover of delta-opioid receptors in the spinal cord of the mouse. Psychopharmacology (Berl). 1997; 133: 347-350.

19. VK Gupta, NT Jaskowiak, MA Beckett, HJ Mauceri, J Grunstein, RS Johnson, DA Calvin, E Nodzenski, M Pejovic, DW Kufe, MC Posner, RR Weichselbaum. Vascular endothelial growth factor enhances endothelial cell survival and tumor radioresistance. Cancer J. 2002; 8: 47-54.

20. PA Singleton, MW Lingen, MJ Fekete, JG Garcia, J Moss. Methylnaltrexone inhibits opiate and VEGF-induced angiogenesis: role of receptor transactivation. Microvasc Res. 2006; 72: 3-11.

21. N Sueoka, E Sueoka, S Okabe, H Fujiki. Anti-cancer effects of morphine through inhibition of tumour necrosis factor-alpha release and mRNA expression. Carcinogenesis. 1996; 17: 2337-2341.

22. R Maneckjee, JD Minna. Opioid and nicotine receptors affect growth regulation of human lung cancer cell lines. Proc Natl Acad Sci U S A. 1990; 87: 3294-3298.

23. M Kawase, H Sakagami, K Furuya, H Kikuchi, H Nishikawa, N Motohashi, Y Morimoto, A Varga, J Molnar. Cell death-inducing activity of opiates in human oral tumor cell lines. Anticancer Res. 2002; 22: 211-214.

24. PI Tsao, M von Zastrow. Type-specific sorting of G protein-coupled receptors after endocytosis. J Biol Chem. 2000; 275: 11130-11140.

25. Sarkar DK, Zhang C. Beta-endorphin neuron regulates stress response and innate immunity to prevent breast cancer growth and progression. Vitam Horm. 2013; 93: 263-276. (doi: 10.1016/B978-0- 12-416673-8.00011-3)

26. Sarkar DK, Murugan S, Zhang C, Boyadjieva N. Regulation of cancer progression by β-endorphin neuron. Cancer Res. 2012 Feb 15; 72(4): 836-840. (doi:10.1158/0008-5472.CAN-11-3292.)

27. Murnyak B, Kouhsari MC, Hershkovitch R, Kalman B, Marko-Varga G, Klekner A, Hortobagyi T. PARP1 expression and its correlation with survival is tumour molecular subtype dependent in glioblastoma. Oncotarget. 2017; 8(28): 46348-46362. (doi: 10.18632/ oncotarget.18013)

Kim S, Im W, Shulipa O, Kim B (2017) RNAi Regulation Profile Comparison in SH-Sy5y and U87 Cells: Response upon β Endorphin. Int J Rare Dis Orphan Drugs 2(2): 1008

Received : 04 May 2017
Accepted : 29 Aug 2017
Published : 27 Sep 2017
Journals
Annals of Otolaryngology and Rhinology
ISSN : 2379-948X
Launched : 2014
JSM Schizophrenia
Launched : 2016
Journal of Nausea
Launched : 2020
JSM Internal Medicine
Launched : 2016
JSM Hepatitis
Launched : 2016
JSM Oro Facial Surgeries
ISSN : 2578-3211
Launched : 2016
Journal of Human Nutrition and Food Science
ISSN : 2333-6706
Launched : 2013
JSM Regenerative Medicine and Bioengineering
ISSN : 2379-0490
Launched : 2013
JSM Spine
ISSN : 2578-3181
Launched : 2016
Archives of Palliative Care
ISSN : 2573-1165
Launched : 2016
JSM Nutritional Disorders
ISSN : 2578-3203
Launched : 2017
Annals of Neurodegenerative Disorders
ISSN : 2476-2032
Launched : 2016
Journal of Fever
ISSN : 2641-7782
Launched : 2017
JSM Bone Marrow Research
ISSN : 2578-3351
Launched : 2016
JSM Mathematics and Statistics
ISSN : 2578-3173
Launched : 2014
Journal of Autoimmunity and Research
ISSN : 2573-1173
Launched : 2014
JSM Arthritis
ISSN : 2475-9155
Launched : 2016
JSM Head and Neck Cancer-Cases and Reviews
ISSN : 2573-1610
Launched : 2016
JSM General Surgery Cases and Images
ISSN : 2573-1564
Launched : 2016
JSM Anatomy and Physiology
ISSN : 2573-1262
Launched : 2016
JSM Dental Surgery
ISSN : 2573-1548
Launched : 2016
Annals of Emergency Surgery
ISSN : 2573-1017
Launched : 2016
Annals of Mens Health and Wellness
ISSN : 2641-7707
Launched : 2017
Journal of Preventive Medicine and Health Care
ISSN : 2576-0084
Launched : 2018
Journal of Chronic Diseases and Management
ISSN : 2573-1300
Launched : 2016
Annals of Vaccines and Immunization
ISSN : 2378-9379
Launched : 2014
JSM Heart Surgery Cases and Images
ISSN : 2578-3157
Launched : 2016
Annals of Reproductive Medicine and Treatment
ISSN : 2573-1092
Launched : 2016
JSM Brain Science
ISSN : 2573-1289
Launched : 2016
JSM Biomarkers
ISSN : 2578-3815
Launched : 2014
JSM Biology
ISSN : 2475-9392
Launched : 2016
Archives of Stem Cell and Research
ISSN : 2578-3580
Launched : 2014
Annals of Clinical and Medical Microbiology
ISSN : 2578-3629
Launched : 2014
JSM Pediatric Surgery
ISSN : 2578-3149
Launched : 2017
Journal of Memory Disorder and Rehabilitation
ISSN : 2578-319X
Launched : 2016
JSM Tropical Medicine and Research
ISSN : 2578-3165
Launched : 2016
JSM Head and Face Medicine
ISSN : 2578-3793
Launched : 2016
JSM Cardiothoracic Surgery
ISSN : 2573-1297
Launched : 2016
JSM Bone and Joint Diseases
ISSN : 2578-3351
Launched : 2017
JSM Bioavailability and Bioequivalence
ISSN : 2641-7812
Launched : 2017
JSM Atherosclerosis
ISSN : 2573-1270
Launched : 2016
Journal of Genitourinary Disorders
ISSN : 2641-7790
Launched : 2017
Journal of Fractures and Sprains
ISSN : 2578-3831
Launched : 2016
Journal of Autism and Epilepsy
ISSN : 2641-7774
Launched : 2016
Annals of Marine Biology and Research
ISSN : 2573-105X
Launched : 2014
JSM Health Education & Primary Health Care
ISSN : 2578-3777
Launched : 2016
JSM Communication Disorders
ISSN : 2578-3807
Launched : 2016
Annals of Musculoskeletal Disorders
ISSN : 2578-3599
Launched : 2016
Annals of Virology and Research
ISSN : 2573-1122
Launched : 2014
JSM Renal Medicine
ISSN : 2573-1637
Launched : 2016
Journal of Muscle Health
ISSN : 2578-3823
Launched : 2016
JSM Genetics and Genomics
ISSN : 2334-1823
Launched : 2013
JSM Anxiety and Depression
ISSN : 2475-9139
Launched : 2016
Clinical Journal of Heart Diseases
ISSN : 2641-7766
Launched : 2016
Annals of Medicinal Chemistry and Research
ISSN : 2378-9336
Launched : 2014
JSM Pain and Management
ISSN : 2578-3378
Launched : 2016
JSM Women's Health
ISSN : 2578-3696
Launched : 2016
Clinical Research in HIV or AIDS
ISSN : 2374-0094
Launched : 2013
Journal of Endocrinology, Diabetes and Obesity
ISSN : 2333-6692
Launched : 2013
Journal of Substance Abuse and Alcoholism
ISSN : 2373-9363
Launched : 2013
JSM Neurosurgery and Spine
ISSN : 2373-9479
Launched : 2013
Journal of Liver and Clinical Research
ISSN : 2379-0830
Launched : 2014
Journal of Drug Design and Research
ISSN : 2379-089X
Launched : 2014
JSM Clinical Oncology and Research
ISSN : 2373-938X
Launched : 2013
JSM Bioinformatics, Genomics and Proteomics
ISSN : 2576-1102
Launched : 2014
JSM Chemistry
ISSN : 2334-1831
Launched : 2013
Journal of Trauma and Care
ISSN : 2573-1246
Launched : 2014
JSM Surgical Oncology and Research
ISSN : 2578-3688
Launched : 2016
Annals of Food Processing and Preservation
ISSN : 2573-1033
Launched : 2016
Journal of Radiology and Radiation Therapy
ISSN : 2333-7095
Launched : 2013
JSM Physical Medicine and Rehabilitation
ISSN : 2578-3572
Launched : 2016
Annals of Clinical Pathology
ISSN : 2373-9282
Launched : 2013
Annals of Cardiovascular Diseases
ISSN : 2641-7731
Launched : 2016
Journal of Behavior
ISSN : 2576-0076
Launched : 2016
Annals of Clinical and Experimental Metabolism
ISSN : 2572-2492
Launched : 2016
Clinical Research in Infectious Diseases
ISSN : 2379-0636
Launched : 2013
JSM Microbiology
ISSN : 2333-6455
Launched : 2013
Journal of Urology and Research
ISSN : 2379-951X
Launched : 2014
Journal of Family Medicine and Community Health
ISSN : 2379-0547
Launched : 2013
Annals of Pregnancy and Care
ISSN : 2578-336X
Launched : 2017
JSM Cell and Developmental Biology
ISSN : 2379-061X
Launched : 2013
Annals of Aquaculture and Research
ISSN : 2379-0881
Launched : 2014
Clinical Research in Pulmonology
ISSN : 2333-6625
Launched : 2013
Journal of Immunology and Clinical Research
ISSN : 2333-6714
Launched : 2013
Annals of Forensic Research and Analysis
ISSN : 2378-9476
Launched : 2014
JSM Biochemistry and Molecular Biology
ISSN : 2333-7109
Launched : 2013
Annals of Breast Cancer Research
ISSN : 2641-7685
Launched : 2016
Annals of Gerontology and Geriatric Research
ISSN : 2378-9409
Launched : 2014
Journal of Sleep Medicine and Disorders
ISSN : 2379-0822
Launched : 2014
JSM Burns and Trauma
ISSN : 2475-9406
Launched : 2016
Chemical Engineering and Process Techniques
ISSN : 2333-6633
Launched : 2013
Annals of Clinical Cytology and Pathology
ISSN : 2475-9430
Launched : 2014
JSM Allergy and Asthma
ISSN : 2573-1254
Launched : 2016
Journal of Neurological Disorders and Stroke
ISSN : 2334-2307
Launched : 2013
Annals of Sports Medicine and Research
ISSN : 2379-0571
Launched : 2014
JSM Sexual Medicine
ISSN : 2578-3718
Launched : 2016
Annals of Vascular Medicine and Research
ISSN : 2378-9344
Launched : 2014
JSM Biotechnology and Biomedical Engineering
ISSN : 2333-7117
Launched : 2013
Journal of Hematology and Transfusion
ISSN : 2333-6684
Launched : 2013
JSM Environmental Science and Ecology
ISSN : 2333-7141
Launched : 2013
Journal of Cardiology and Clinical Research
ISSN : 2333-6676
Launched : 2013
JSM Nanotechnology and Nanomedicine
ISSN : 2334-1815
Launched : 2013
Journal of Ear, Nose and Throat Disorders
ISSN : 2475-9473
Launched : 2016
JSM Ophthalmology
ISSN : 2333-6447
Launched : 2013
Journal of Pharmacology and Clinical Toxicology
ISSN : 2333-7079
Launched : 2013
Annals of Psychiatry and Mental Health
ISSN : 2374-0124
Launched : 2013
Medical Journal of Obstetrics and Gynecology
ISSN : 2333-6439
Launched : 2013
Annals of Pediatrics and Child Health
ISSN : 2373-9312
Launched : 2013
JSM Clinical Pharmaceutics
ISSN : 2379-9498
Launched : 2014
JSM Foot and Ankle
ISSN : 2475-9112
Launched : 2016
JSM Alzheimer's Disease and Related Dementia
ISSN : 2378-9565
Launched : 2014
Journal of Addiction Medicine and Therapy
ISSN : 2333-665X
Launched : 2013
Journal of Veterinary Medicine and Research
ISSN : 2378-931X
Launched : 2013
Annals of Public Health and Research
ISSN : 2378-9328
Launched : 2014
Annals of Orthopedics and Rheumatology
ISSN : 2373-9290
Launched : 2013
Journal of Clinical Nephrology and Research
ISSN : 2379-0652
Launched : 2014
Annals of Community Medicine and Practice
ISSN : 2475-9465
Launched : 2014
Annals of Biometrics and Biostatistics
ISSN : 2374-0116
Launched : 2013
JSM Clinical Case Reports
ISSN : 2373-9819
Launched : 2013
Journal of Cancer Biology and Research
ISSN : 2373-9436
Launched : 2013
Journal of Surgery and Transplantation Science
ISSN : 2379-0911
Launched : 2013
Journal of Dermatology and Clinical Research
ISSN : 2373-9371
Launched : 2013
JSM Gastroenterology and Hepatology
ISSN : 2373-9487
Launched : 2013
TEST Journal of Dentistry
ISSN : 1234-5678
Launched : 2014
Annals of Nursing and Practice
ISSN : 2379-9501
Launched : 2014
JSM Dentistry
ISSN : 2333-7133
Launched : 2013
Author Information X