Loading

JSM Microbiology

Antibiotic Profiling and Detection of blaimp-1 and blavim-2 in Carbapenem-Resistant Acinetobacter baumannii and Pseudomonas aeruginosa from Selected Tertiary Hospitals in Metro Manila, Philippines

Research Article | Open Access Volume 5 | Issue 3 |

  • 1. Department of Medical Technology, University of Santo Tomas, Philippines
  • 2. Department of Laboratory Medicine, University of Santo Tomas, Philippines
  • 3. Research Center for the Natural and Applied Sciences, University of Santo Tomas, Philippines
+ Show More - Show Less
Corresponding Authors
Sherill Tesalona, Department of Medical Technology, Faculty of Pharmacy, University of Santo Tomas, 1015 Manila, Philippines Tel: 639178283595
Abstract

Introduction: Acinetobacter baumannii and Pseudomonas aeruginosa are common opportunistic bacteria causing nosocomial infections among hospitalized  patients. Aside from being opportunistic, these bacteria, nowadays, are exhibiting resistance to some antibiotics, making antibiotic therapy difficult and  challenging. With this, we aimed to determine the presence of some resistance-causing genes such as blaIMP-1 and blaVIM-2, from carbapenem-resistant A.baumannii (CRAB) and carbapenem-resistant P. aeruginosa (CRPA).
Methodology: Purposive sampling was used wherein all CRAB and CRPA isolates were collected from two selected tertiary hospitals in Metro Manila,  Philippines. Phenotypic  and antibiotic susceptibility testing of the isolates were done using VITEK® 2 Compact. Carbapenem resistance was  retestedusing Kirby-Bauer disk diffusion method. For the genotypic identification of the presence of blaIMP-1 and blaVIM-2, the deoxyribonucleic acid (DNA) of  the samples was isolated and purified.It was thenamplified through  polymerase chain reaction (PCR).Amplicons produced were run through gel  electrophoresis for the visualization of bands indicating the presence of blaIMP-1 at 740 bp and blaVIM-2 at 865 bp.
Results: We detected the genes blaIMP-1 and blaVIM-2 in four (58%) and one (14%) CRAB isolates, respectively. One (14%) isolate has both blaIMP-1 and  blaVIM-2. While in CRPA isolates, only blaIMP-1was detected in two (67%) isolates. In terms of the antibiotic profiling of the isolates with blaIMP-1 and blaVIM-2, we  found that all are resistant against ceftazidime and ciprofloxacin (100%); seven (87.5%) against cefepime, gentamicin, and piperacillin/tazobactam; and  one (12.5%) against amikacin. Furthermore, the antibiotic profile of the isolates with no blaIMP-1 and blaVIM-2 are the following: all are resistant against cefepime,  ceftazidime, ciprofloxacin, gentamicin, and piperacillin/tazobactam (100%). On the other hand, both blaIMP-1 and blaVIM-2 negative isolates are sensitive to  amikacin. All isolates (100%) are sensitive against colistin. 
Conclusion: We conclude thatblaIMP-1 is present in CRAB and CRPA, and itis more frequent thanblaVIM-2.This study also concludes the coexistence of multiple metallo-β-lactamase genes in CRAB isolates.

Keywords

• Multi-drug resistance

• Metallo-beta-lactamase

• PCR

• Antibiotic susceptibility

• blaIMP-1, blaVIM-2

• Acinetobacter baumannii

• Pseudomonas aeruginosa

Citations

Tesalona S, Lagamayo E, Tuban E, Ello MG, Hoshina R, et al. (2017) Antibiotic Profiling and Detection of blaimp-1 and blavim-2 in Carbapenem-Resistant Acinetobacter baumannii and Pseudomonas aeruginosa from Selected Tertiary Hospitals in Metro Manila, Philippines. JSM Microbiology 5(3): 1044.

ABBREVIATIONS

CRPA: Carbapenem-Resistant P. aeruginosa; CRAB: Carabapenem-Resistant A. baumannii; IMP: Imipenem Hydrolyzing Carbapenemases; VIM: Verona-Integron Metallo-β-lactamase; PCR: Polymerase Chain Reaction

INTRODUCTION

Acinetobacter baumannii and Pseudomonas aeruginosa have emerged globally, especially in the hospital setting, as these cause fatal nosocomial infections, such as hospital-acquired pneumonia, urinary tract infection, bacteremia, and chronic obstructive pulmonary disease [1,2]. These gram-negative bacteria have been reported to exhibit multidrug resistance on carbapenems and third-generation cephalosporins, and are classified as the most critical groups in need for new alternative antibiotics [3,4]. The increasing prevalence of carbapenem-resistance in major nosocomial pathogens, such as A. baumannii and P. aeruginosa, necessitates intensive measures for diagnosis and treatment as well as correct use of antibiotics.

MATERIALS AND METHODS

Sampling technique

Purposive sampling technique was used in this study.

Specimen collection, transport, and storage

All CRAB and CRPA isolates were from November 2016 to March 2017 from two selected tertiary hospitals in Metro Manila, Philippines.Only 10 samples were gathered. All the collected samples were pre-identified to be resistant to carbapenem through antibiotic susceptibility testing (AST) using VITEK® 2 Compactconducted in the laboratory where the samples were obtained. Patients’ nameswere de-identified from the isolates, and only case numbers were used to protect patients’ privacy. The isolates were inoculated into nutrient agar (NA) for transport to the UST Faculty of Medicine and Surgery - Department of Laboratory Medicine, where the specimens were further processed. All biosafety measures recommended by the World Health Organization (WHO) on proper specimen collection, transport, and disposal were followed.

Phenotypic testing

Bacterial identification and Antibiotic susceptibility testing (AST): Pre-identification of all the isolates up to species level and antibiotic susceptibility testing were done using VITEK® 2 Compact. Susceptibility for carbapenem was retested usingthe Kirby-Bauer disk diffusion method following the CLSI Guidelines 2017 [5].

Genotypic testing

DNA lysate preparation: For the preparation of DNA lysate, a single-step liquid-phase separation method based on the Wizard® Genomic DNA Purification Kit Technical Manual by Promega (2014) was used.

DNA purification using Nanodrop: Measurement of DNA concentration is an important procedure in molecular biology. This ensures that all isolated DNA samples are in its purest form and free of any impurities or protein contaminations. Absorption spectroscopy method was used in this experiment using a spectrophotometer machine. For quantitative measurements of pure nucleic acid, absorbance with a wavelength of A260, A280, and A320 were used [6].

Polymerase chain reaction (PCR)

For PCR, a Master Mix using Promega M782A was prepared. This contained Go Taq G2 Green Master Mix that includes DNA polymerase enzyme (Taq: Thermus aquaticus). PCR nuclease water as well as forward and reverse primers of blaIMP-1 and blaVIM-2 were added to the master mix to delineate a specific region to be amplified.

Controls: Astrain of A. baumannii with a known blaIMP-1 confirmed by DNA sequencing and BLAST was used as a positive control. The positive control has query coverage of 95.0% and an88.0% similarity based on BLAST search of blaIMP-1 sequence [7].

Primers: The primers used for amplification were: (1) IMP-1 Forward TGAGCAAGTTATCTGTATTC and Reverse TTAGTTGCTTGGTTTTGATG with a size of 740 bp amplicon and (2) VIM-2 Forward AAAGTTATGCCGCACTCACC and Reverse TGCAACTTCATGTTATGCCG with a size of 865 bp amplicon [8].

Amplification of blaIMP-1 and blaVIM-2: The DNA amplification kit used for amplifying nucleic acid contained DNA polymerase, primers, nuclease-free water, and template DNA. The reaction mixture was prepared simultaneously as the DNA working lysate were immersed in an ice bath. The mixture was composed of 225 μL Go Taq G2 Green Master Mix, 153 μL PCR nuclease-free water, and 9 μL of each forward and reverse primer. The template DNA of 3 μL was added to 22.0 μL of the reaction mixture. The same process was done to the negative control. Furthermore, the cycling parameters used for blaIMP-1 and blaVIM-2 were as follows: the initial incubation step required one cycle at 94°C for 3 minutes, followed by 35 cycles of denaturation at 94°C for 1 minute, annealing at 55°C for 1 minute, extension at 72°C for 2 minutes, and final extension at 72°C for 7 minutes (Swift MaxPro Thermal Cycler [8].

Amplified Product Detection (Gel Electrophoresis): Visualization of PCR products was done by using gel electrophoresis in 1x TAE buffer (0.04 M Tris-acetate, 0.002 M EDTA [pH 8.5]) with 2.0 µL gel red dye. One percent (1%) agarose gel with 1.0 µL gel red dye was used to run the amplicon soaked in 1x TAE buffer. An amount of 5.0 µL of DNA amplicon mixed with 1.0 µL 6x loading dye was placed to the wells of the prepared 1% agarose gel block located on the electrophoresis tank. For the DNA marker, 5 µL of 1 kb DNA ladder was used. As a protocol, electrophoresis machine conditions were set to 100V, 500 MA for 60 minutes. The results of the gel electrophoresis were viewed and photographed (C.B.S Scientific EPS-300 IIV and Cleaver Scientific nanoPAC300 mini) [8].

RESULTS AND DISCUSSION

In our study, we were able to gather only 10 isolates from two selected tertiary hospitals in Metro Manila, Philippines. The isolates were collected from nine (9) (90%) hospitalized patients, mostly from intensive care units (ICUs), and only one (1) (10%) from an out-patient; mostlyfrom males (60% males and 40% females); and with ages ranging from 41 to 65 years. Based on the pre-identification conducted by the hospital laboratories where the specimens were obtained, all the isolates are either carbapenem-resistant A. baumanii or P. aeruginosa using VITEK® 2 Compact.

Table 1A shows

Table 1A: Antibiotic resistance profile of 7 CRAB and 3 CRPA isolates, blaIMP-1- and blaVIM-2-producing and non-producing strains interpreted based on CLSI Guidelines 2017 collected from two selected tertiary hospitals in Metro Manila from November 2016 to March 2017.

Antibiotics

CRAB and CRPA isolates (n=10)

blaIMP-1- and/or

blaVIM-2- positive (n=8)

Negative (n=2)

p-value

Conclusion

n

%

n

%

n

%

Amikacin

1

10

1

12.5

0

0

1.000

NS

Cefepime

7

70

7

87.5

2

100

1.000

NS

Ceftazidime

8

80

8

100

2

100

1.000

NS

Ciprofloxacin

10

100

8

100

2

100

1.000

NS

Gentamicin

9

90

7

87.5

2

100

1.000

NS

Piperacillin/Tazobactam

9

90

7

87.5

2

100

1.000

NS

Colistin

0

0

0

0

0

0

-

-

Tested at p=0.05

CRAB: Carbapenem-resistant Acinetobacter baumanii; CRPA: Carbapenem-resistant Pseudomonas aeruginosa; IMP: Imipenem hydrolyzing Metallo-β-Lactamase; VIM: Verona-integron encoded Metallo-β- lactamase; NS: No significance

that all (8/8) isolates of CRAB and CRPA positive for blaIMP-1/blaVIM-2 have the following antibiotic resistance profile: ceftazidime and ciprofloxacin 8 (100%), cefepime, gentamicin, and piperacillin/tazobactam 7 (87.5%), and amikacin, 1 (12.5%), whereas colistin has 0% resistance. Furthermore, all (100%) CRAB and CRPA isolates negative for blaIMP-1/blaVIM-2 have the following resistance profile: 100% resistance to cefepime, ceftazidime, ciprofloxacin, gentamicin, and piperacillin/tazobactam, whereas it has 0% resistance to amikacin and colistin. Table 1B shows

Table 1B: Antibiotic Resistance Profile of all (10) CRAB and CRPA isolates

Isolates

PCR result

Antibiotics

blaIMP-1

blaVIM-2

IMP/MEM

AN

FEP

CAZ

CIP

GN

TZP

COL

(+) Control

blaIMP-1

POS

(-) Control

Nuclease-free water

NEG

NEG

Acinetobacter baumannii

1

AB01

NEG

POS

R

NR

R

R

R

R

R

NR

2

AB02

POS

NEG

R

NR

R

R

R

R

R

NR

3

AB03

POS

NEG

R

NR

R

R

R

R

R

NR

4

AB04

NEG

NEG

R

NR

R

R

R

R

R

NR

5

AB05

POS

POS

R

NR

R

R

R

R

R

NR

6

AB06

POS

NEG

R

NR

R

R

R

R

R

NR

7

AB07

POS

NEG

R

NR

R

R

R

R

R

NR

Pseudomonas aeruginosa

8

PA01

POS

NEG

R

R

NR

R

R

R

NR

NR

9

PA02

POS

NEG

R

NR

R

R

R

NR

R

NR

10

PA03

NEG

NEG

R

NR

R

R

R

R

R

NR

AB: Carbapenem-resistant Acinetobacter baumanii; PA: Carbapenem-resistant Pseudomonas aeruginosa; IMP: Imipenem; MEM: Meropenem; AN: Amikacin; FEP: Cefepime, CAZ: Ceftazidime; CIP: Ciprofloxacin; GN: Gentamicin; TZP: Piperacillin/Tazobactam; COL: Colistin

the patterns of antibiotic resistance all 10 strains.

To test for the presence of blaIMP-1 and blaVIM-2, which we hypothesized to be responsible for the resistance profile, we performed DNA isolation and conventional PCR and visualized band formation using gel electrophoresis. Table 2 and Figures 1 and 2 show

Figure 1A: Gel electropherogram for blaIMP-1 (740 bp) 1st batch Isolates AB-01, AB-02, AB-03, AB-04, and AB-05 for blaIMP-1 detection; AB-02, AB-03, and AB-05 are positive; DNA ladder (L); Positive control (+); Negative control (-)

Figure 1A: Gel electropherogram for blaIMP-1 (740 bp) 1st batch

Isolates AB-01, AB-02, AB-03, AB-04, and AB-05 for blaIMP-1 detection; AB-02, AB-03, and AB-05 are positive; DNA ladder (L); Positive control (+); Negative control (-)

Figure 1B: Gel electropherogram for blaIMP-1 (740 bp) 2nd batch. Isolates AB-06, AB-07, PA-01, PA-02, and PA-03 for blaIMP-1 detection; AB-06, AB-07, PA-01, and PA-02 are positive; DNA ladder (L); Positive control (+); Negative control (-).

Figure 1B: Gel electropherogram for blaIMP-1 (740 bp) 2nd batch.

Isolates AB-06, AB-07, PA-01, PA-02, and PA-03 for blaIMP-1 detection; AB-06, AB-07, PA-01, and PA-02 are positive; DNA ladder (L); Positive control (+); Negative control (-).

Figure 2A: Gel electropherogram for blaVIM-2 (865 bp)1st batch. Isolates AB-01, AB-02, AB-03, AB-04, AB-05, and AB-06 for blaVIM-2 detection; AB-01 and AB-05 are positive; DNA ladder (L); Negative control (-).

Figure 2A: Gel electropherogram for blaVIM-2 (865 bp)1st batch.

Isolates AB-01, AB-02, AB-03, AB-04, AB-05, and AB-06 for blaVIM-2 detection; AB-01 and AB-05 are positive; DNA ladder (L); Negative control (-).

Figure 2B: Gel electropherogram for blaVIM-2 (865 bp) 2nd batch. Isolates, AB-07, PA-01, PA-02, and PA-03 for blaVIM-2 detection and all are negative for blaVIM-2, DNA ladder (L); Negative control (-).

Figure 2B: Gel electropherogram for blaVIM-2 (865 bp) 2nd batch.

Table 2: Distribution of blaIMP-1 and blaVIM-2 in 7 CRAB and 3 CRPA isolates collected from two selected tertiary hospitals in Metro Manila from November 2016 to March 2017

 

Genotypes

CRAB Isolates (n=7)

CRPA Isolates (n=3)

CRAB

%

CRPA

%

 

blaIMP-1 only

 

4

 

2

 

58

 

67

 

blaVIM-2 only

 

1

 

0

 

14

 

0

 

both blaIMP-1 and blaVIM-2

 

1

 

0

 

14

 

0

 

blagene (-)

 

1

 

1

 

14

 

33

 

Total

 

7

 

3

 

100

 

100

CRAB: Carbapenem-resistant Acinetobacter baumanii; CRPA: Carbapenem-resistant Pseudomonas aeruginosa; IMP: Imipenem hydrolyzing Metallo-β-Lactamase; VIM: Verona-integron encoded Metallo-β- lactamase

Table 3A: Distribution of blaIMP-1 and blaVIM-2 in CRAB strains from various specimens collected from selected tertiary hospitals in Metro Manila from November 2016 to March 2017.

 

 

 

 

Specimens

 

blaIMP-1/blaVIM-2

 

Total CRAB

 

Positive

 

Negative

 

n

 

%

 

n

 

%

 

n

 

%

 

Respiratory specimens

 

2

 

29

 

1

 

14

 

3

 

42

 

Exudative specimens

 

2

 

29

 

0

 

0

 

2

 

29

 

Urine

 

2

 

29

 

0

 

0

 

2

 

29

 

Blood

 

0

 

0

 

0

 

0

 

0

 

0

Total

6

87

1

14

7

100

CRAB: Carbapenem-resistant Acinetobacter baumanii; CRPA: Carbapenem-resistant Pseudomonas aeruginosa; IMP: Imipenem hydrolyzing Metallo-β-Lactamase; VIM: Verona-integron encoded Metallo-β- lactamase

Table 3B: Distribution of blaIMP-1 and blaVIM-2 in CRPA strains from various specimens collected from selected tertiary hospitals in Metro Manila from November 2016 to March 2017

 

 

Specimens

 

blaIMP-1/blaVIM-2

 

Total CRPA

 

Positive

 

Negative

 

 

n

 

 

%

 

n

 

%

 

n

 

%

 

Respiratory specimens

 

0

 

0

 

1

 

33

 

1

 

33

 

Exudative specimens

 

1

 

33

 

0

 

0

 

1

 

33

 

Urine

 

0

 

0

 

0

 

0

 

0

 

0

 

Blood

 

1

 

33

 

0

 

0

 

1

 

33

 

Total

 

2

 

66

 

1

 

33

 

3

 

100

CRAB: Carbapenem-resistant Acinetobacter baumanii; CRPA: Carbapenem-resistant Pseudomonas aeruginosa; IMP: Imipenem hydrolyzing Metallo-β-Lactamase; VIM: Verona-integron encoded Metallo-β- lactamase

Isolates, AB-07, PA-01, PA-02, and PA-03 for blaVIM-2 detection and all are negative for blaVIM-2, DNA ladder (L); Negative control (-).

that four CRAB isolates(58%) were positive for blaIMP-1(740 bp) and 1(14%) forblaVIM-2(865bp). One isolate (14%) had both blaIMP-1 and blaVIM-2, which demonstrated possible coexistence of multiple MBL genes [9].BlaVIM-2 was not detected among CRPA isolates. Furthermore, two out of the three CRPA isolates carried theblaIMP-1gene. In this research, blaIMP-1 was more prevalent than blaVIM-2.

A study in India showed a similar result with 42% total prevalence of blaIMP-1 and blaVIM-2,whereinblaIMP-1was more prevalent [10]. MBL genes can induce genetic apparatuses to become highly mobile since these are associated with integrons embedded in transposons, hence, making the MBL gene dissemination likely to occur. The higher distribution of blaIMP-1 in CRPA was also evident in the studies of Tesalona et al., (unpublished) in the Philippines and Azim et al., (2009) [7,11] in India with results of 9 (90%) and 7 (58%), respectively. By contrast, in a study performed in Iran among burn patients, none of the 65 CRAB isolates collected contained blaIMP, while eight (12.5%) strains carried blaVIM. Six out of eight VIM-producing strains contained both blaOXA-23 and blaVIM genes [18].

CRAB isolates used in the study were from respiratory (42%), exudative (29%), and urine (29%) specimens as shown in Table 3A,B, while CRPA isolates were from respiratory specimen (33%), exudative specimen (33%), and blood (33%). The most frequent specimen where CRAB or CRPA isolates can be isolated cannot be determined in this study because of the limited number of isolates collected. In previous studies, common sources of CRAB and CRPA isolates were those from respiratory and urethral catheters. These catheters served as surface for bacterial adhesion that can promote widespread distribution of the bacteria [12]. In the studies of Tesalona et al., (unpublished) and Amudhan et al., (2012), the primary sources of isolates were respiratory secretions and urine specimens [7,9].On the contrary, wound exudates from burn patients in Iran were the primary source of 39% CRAB and 38% CRPA isolates that were also MBL producers. Burn wounds harbor bacteria to thrive and become sources of infection as larger areas and longer duration of hospitalization are involved [16,17]. Further study involving more isolates may be done to identify the most frequent specimen source of CRAB and CRPA isolates.

The presence of genes causing resistance to antibiotics is an important mechanism to explore in the study of multidrugresistant bacterial pathogens, especially among bacteria-causing nosocomial infections. Patients staying in the hospital for prolonged periods are at high risk for such nosocomial infections. Moreover, the risk for such infections is worsened by the spread of multidrug-resistant bacterial strains.

Multidrug-resistance develops due to microbial alterations caused by genetic mutation, modification in efflux mechanism, and changes in cell morphology. The Center for Disease Control (CDC) in Europe recorded a total of 25,000 deaths per year and 2.5 million additional hospital days due to antibiotic resistance, while over 58,000 babies died within a year in India due to resistant bacterial infection transmitted by their mothers.

In this study, we focused on beta-lactam resistance of A. baumanii and P. aeruginosa. The primary mechanism of betalactam resistance employs destruction of beta-lactam ring by beta-lactamases, hydrolyzing the amide bond of the ring. Genes encoding for these enzymes are termed as bla succeeded by their specific name (e.g.,blaIMP). In addition, these genes can be found as parts of accessory genome or integrons[8].One of the most resilient beta-lactam enzymes, carbapenemase, has the ability to hydrolyze carbapenems, rendering the bacteria resistant. It has several classes and subclasses depending on the amino acid homology: Classes A, C, and D use serine as their active site; Class B (BI, BII, and BIII) uses zinc as the active site. Subclass BIis further divided into four categories based on their molecular structures: IMP, VIM, GIM, and SPM types [8]. IMP-1 was first discovered in Serratia marcescens in Japan in 1991, VIM-1 in Italy in 1997, GIM in Germany in 2002, and SPM-1 in Brazil in 1997[12,13]. These genes are encoded in integrons that specify aminoglycoside 6’-N-acetyltransferases, making easier horizontal transfer among different species of bacteria possible [15].The gene blaIMP “active on imipenem” was first discovered in a P. aeruginosa strain GN17203. The isolate possessed an imipenem MIC of 50 µg/ml as well as resistance to extended-spectrum such as cephalosporins, a ceftazidime MIC of >400 µg/ml. The resistance allele, IMP-1, was found on a transferable conjugative plasmid that could be readily mobilized to other Pseudomonas strains [8]. So far, there are 23 different IMP MBLs that have been identified.

Another prevalent MBL family is the “Verona integrinencoded metallo-beta lactamase” (VIM) that was first isolated in Verona, Italy in the form of VIM-1 and VIM-2. The VIM family is comprised of 14 members, most of which have occurrences in P. aeruginosa within multiple-integron cassette structures [8]. The VIM-type MBLs have been widespread in Asia, Southern Europe, and North America. In 2000, Antibiotic Resistance Monitoring and Reference Laboratory had received approximately 80 isolates, mostly Pseudomonas species from the United Kingdom, which tested positive for blaVIM[13].

In the present study, we were able to detect the presence of both blaIMP-1 and blaVIM-2 in our isolates. We only have 10 isolates and yet the two genes that are probable for causing drug resistance, were detected. It is therefore recommended that hospitals should have regular screening strategies to monitor multi-drug resistance especially among bacteria causing nosocomial infections.

CONCLUSION

We conclude that blaIMP-1 and blaVIM-2 are present in CRAB and CRPA isolates.BlaIMP-1in CRAB and CRPA is more prevalent than blaVIM-2. The coexistence of multiple genes was also observed. Further studies on the presence of these genes in a larger scale of isolates may be done to be able to identify if the genes are associated with resistance against antibiotics.

ACKNOWLEDGEMENT

The researchers would like to express their sincerest gratitude and appreciation to the following people who helped them in the completion of this study: Ma. Lourdes D. Maglinao, MD, FPSP; Ma. Grace Bernales, RMT; and Ace Bryan S. Cabal, MSPH.

REFERENCES
  1. Almasaudi SB. Acinetobacter spp. as nosocomial pathogens: Epidemiology and resistance features. Saudi J Biol Sci. 2016.
  2. Tsioutis C, Kritsotakis EI, Karageorgos SA, Stratakou S, Psarologakis C, Kokkini S, et al. Clinical epidemiology, treatment and prognostic factors of extensively drug-resistant Acinetobacter baumannii ventilator-associated pneumonia in critically ill patients. Int J Antimicrob Agents. 2016; 48: 492-497.
  3. Hawkey PM. Carbapenem antibiotics for serious infections. BMJ. 2012; 344: e3236.
  4. WHO. WHO publishes list of bacteria for which new antibiotics are urgently needed. World Health Organization Media Centre. Journals of the World Health Organization. 2017.
  5. CLSI. Guidelines in Interpretation Antimicrobial Susceptibility Testing. CLSI. 2017.
  6. Gallagher SR. Quantitation of DNA and RNA with Absorption and Fluorescence Spectroscopy. Curr Protoc Protein Sci. 2008.
  7. Tesalona SD. Antibiotic Profiling and Detection of blaVIM, blaIMP, and blaSPM in carbapenem-resistant Pseudomonas aeruginosa Isolated in Tertiary Hospitals in Metro Manila, Philippines. Unpublished. 2015.
  8. Queenan AM, Bush K. Carbapenemases: the versatile beta-lactamases. Clin Microbiol Rev. 2007; 20: 440-458.
  9. Dwivedi M, Mishra A, Azim A, Singh RK, Baronia AK, Prasad KN, et al. Ventilator-associated pneumonia caused by carbapenem-resistant Enterobacteriaceae carrying multiple metallo-beta-lactamase genes.  Indian J Pathol Microbiol. 2009; 52: 339-342.
  10. Amudhan MS, Sekar U, Kamalanathan A, Balaraman S. bla(IMP) and bla(VIM) mediated carbapenem resistance in Pseudomonas and Acinetobacter species in India. J Infect Dev Ctries. 2012; 6: 757-762.
  11. Perez F, Endimiani A, Ray AJ, Decker BK, Wallace CJ, Hujer KM, et al. Carbapenem-resistant Acinetobacter baumannii and Klebsiella pneumoniae across a hospital system: impact of post-acute care facilities on dissemination. J Antimicrob Chemother. 2010; 65: 1807-1818.
  12. Fournier PE, Richet H. The epidemiology and control of Acinetobacter baumannii in health care facilities. Clin Infect Dis. 2006; 42: 692-9.
  13. Walsh TR, Toleman MA, Poirel L, Nordmann P. Metallo-beta-lactamases: the quiet before the storm? Clin Microbiol Rev. 2005; 18: 306-25.
  14. Dortet L, Poirel L, Nordmann P. Further proofs of concept for the Carba NP test. Antimicrob Agents Chemother. 2014; 58: 1269.  
  15. Gibb AP, Tribuddharat C, Moore RA, Louie TJ, Krulicki W, Livermore DM , et al. Nosocomial outbreak of carbapenem-resistant Pseudomonas aeruginosa with a new bla(IMP) allele, bla(IMP-7). Antimicrob Agents Chemother. 2002; 46: 255-8.
  16. Owlia P ,  Azimi L ,  Gholami A ,  Asghari B ,  Lari AR. ESBL and MBL Mediated Resistance in Acinetobacter baumannii: a global threat to burnt patients. Le infezioni in medicina: rivistaperiodica di eziologia, epidemiologia, diagnostica, clinica e terapiadellepatologieinfettive. 2012; 20: 182-187.
  17. Vahdani M, Azimi L, Asghari B, Bazmi F, Rastegar Lari A. Phenotypic screening of extended-spectrum β-lactamase and metallo- β -lactamase in multidrug-resistant Pseudomonas aeruginosa from infected burns. Ann Burns Fire Disasters. 2012; 25: 78-81.
  18. Azimi L, Talebi M, Pourshafie MR, Owlia P, Rastegar Lari A. Characterization of Carbapenemases in Extensively Drug Resistance Acinetobacter baumannii in a Burn Care Center in Iran. Int J Mol Cell Med. 2015; 4: 46-53.

Tesalona S, Lagamayo E, Tuban E, Ello MG, Hoshina R, et al. (2017) Antibiotic Profiling and Detection of blaimp-1 and blavim-2 in Carbapenem-Resistant Acinetobacter baumannii and Pseudomonas aeruginosa from Selected Tertiary Hospitals in Metro Manila, Philippines. JSM Microbiology 5(3): 1044.

Received : 18 Jan 2017
Accepted : 25 Sep 2017
Published : 29 Sep 2017
Journals
Annals of Otolaryngology and Rhinology
ISSN : 2379-948X
Launched : 2014
JSM Schizophrenia
Launched : 2016
Journal of Nausea
Launched : 2020
JSM Internal Medicine
Launched : 2016
JSM Hepatitis
Launched : 2016
JSM Oro Facial Surgeries
ISSN : 2578-3211
Launched : 2016
Journal of Human Nutrition and Food Science
ISSN : 2333-6706
Launched : 2013
JSM Regenerative Medicine and Bioengineering
ISSN : 2379-0490
Launched : 2013
JSM Spine
ISSN : 2578-3181
Launched : 2016
Archives of Palliative Care
ISSN : 2573-1165
Launched : 2016
JSM Nutritional Disorders
ISSN : 2578-3203
Launched : 2017
Annals of Neurodegenerative Disorders
ISSN : 2476-2032
Launched : 2016
Journal of Fever
ISSN : 2641-7782
Launched : 2017
JSM Bone Marrow Research
ISSN : 2578-3351
Launched : 2016
JSM Mathematics and Statistics
ISSN : 2578-3173
Launched : 2014
Journal of Autoimmunity and Research
ISSN : 2573-1173
Launched : 2014
JSM Arthritis
ISSN : 2475-9155
Launched : 2016
JSM Head and Neck Cancer-Cases and Reviews
ISSN : 2573-1610
Launched : 2016
JSM General Surgery Cases and Images
ISSN : 2573-1564
Launched : 2016
JSM Anatomy and Physiology
ISSN : 2573-1262
Launched : 2016
JSM Dental Surgery
ISSN : 2573-1548
Launched : 2016
Annals of Emergency Surgery
ISSN : 2573-1017
Launched : 2016
Annals of Mens Health and Wellness
ISSN : 2641-7707
Launched : 2017
Journal of Preventive Medicine and Health Care
ISSN : 2576-0084
Launched : 2018
Journal of Chronic Diseases and Management
ISSN : 2573-1300
Launched : 2016
Annals of Vaccines and Immunization
ISSN : 2378-9379
Launched : 2014
JSM Heart Surgery Cases and Images
ISSN : 2578-3157
Launched : 2016
Annals of Reproductive Medicine and Treatment
ISSN : 2573-1092
Launched : 2016
JSM Brain Science
ISSN : 2573-1289
Launched : 2016
JSM Biomarkers
ISSN : 2578-3815
Launched : 2014
JSM Biology
ISSN : 2475-9392
Launched : 2016
Archives of Stem Cell and Research
ISSN : 2578-3580
Launched : 2014
Annals of Clinical and Medical Microbiology
ISSN : 2578-3629
Launched : 2014
JSM Pediatric Surgery
ISSN : 2578-3149
Launched : 2017
Journal of Memory Disorder and Rehabilitation
ISSN : 2578-319X
Launched : 2016
JSM Tropical Medicine and Research
ISSN : 2578-3165
Launched : 2016
JSM Head and Face Medicine
ISSN : 2578-3793
Launched : 2016
JSM Cardiothoracic Surgery
ISSN : 2573-1297
Launched : 2016
JSM Bone and Joint Diseases
ISSN : 2578-3351
Launched : 2017
JSM Bioavailability and Bioequivalence
ISSN : 2641-7812
Launched : 2017
JSM Atherosclerosis
ISSN : 2573-1270
Launched : 2016
Journal of Genitourinary Disorders
ISSN : 2641-7790
Launched : 2017
Journal of Fractures and Sprains
ISSN : 2578-3831
Launched : 2016
Journal of Autism and Epilepsy
ISSN : 2641-7774
Launched : 2016
Annals of Marine Biology and Research
ISSN : 2573-105X
Launched : 2014
JSM Health Education & Primary Health Care
ISSN : 2578-3777
Launched : 2016
JSM Communication Disorders
ISSN : 2578-3807
Launched : 2016
Annals of Musculoskeletal Disorders
ISSN : 2578-3599
Launched : 2016
Annals of Virology and Research
ISSN : 2573-1122
Launched : 2014
JSM Renal Medicine
ISSN : 2573-1637
Launched : 2016
Journal of Muscle Health
ISSN : 2578-3823
Launched : 2016
JSM Genetics and Genomics
ISSN : 2334-1823
Launched : 2013
JSM Anxiety and Depression
ISSN : 2475-9139
Launched : 2016
Clinical Journal of Heart Diseases
ISSN : 2641-7766
Launched : 2016
Annals of Medicinal Chemistry and Research
ISSN : 2378-9336
Launched : 2014
JSM Pain and Management
ISSN : 2578-3378
Launched : 2016
JSM Women's Health
ISSN : 2578-3696
Launched : 2016
Clinical Research in HIV or AIDS
ISSN : 2374-0094
Launched : 2013
Journal of Endocrinology, Diabetes and Obesity
ISSN : 2333-6692
Launched : 2013
Journal of Substance Abuse and Alcoholism
ISSN : 2373-9363
Launched : 2013
JSM Neurosurgery and Spine
ISSN : 2373-9479
Launched : 2013
Journal of Liver and Clinical Research
ISSN : 2379-0830
Launched : 2014
Journal of Drug Design and Research
ISSN : 2379-089X
Launched : 2014
JSM Clinical Oncology and Research
ISSN : 2373-938X
Launched : 2013
JSM Bioinformatics, Genomics and Proteomics
ISSN : 2576-1102
Launched : 2014
JSM Chemistry
ISSN : 2334-1831
Launched : 2013
Journal of Trauma and Care
ISSN : 2573-1246
Launched : 2014
JSM Surgical Oncology and Research
ISSN : 2578-3688
Launched : 2016
Annals of Food Processing and Preservation
ISSN : 2573-1033
Launched : 2016
Journal of Radiology and Radiation Therapy
ISSN : 2333-7095
Launched : 2013
JSM Physical Medicine and Rehabilitation
ISSN : 2578-3572
Launched : 2016
Annals of Clinical Pathology
ISSN : 2373-9282
Launched : 2013
Annals of Cardiovascular Diseases
ISSN : 2641-7731
Launched : 2016
Journal of Behavior
ISSN : 2576-0076
Launched : 2016
Annals of Clinical and Experimental Metabolism
ISSN : 2572-2492
Launched : 2016
Clinical Research in Infectious Diseases
ISSN : 2379-0636
Launched : 2013
Journal of Urology and Research
ISSN : 2379-951X
Launched : 2014
Journal of Family Medicine and Community Health
ISSN : 2379-0547
Launched : 2013
Annals of Pregnancy and Care
ISSN : 2578-336X
Launched : 2017
JSM Cell and Developmental Biology
ISSN : 2379-061X
Launched : 2013
Annals of Aquaculture and Research
ISSN : 2379-0881
Launched : 2014
Clinical Research in Pulmonology
ISSN : 2333-6625
Launched : 2013
Journal of Immunology and Clinical Research
ISSN : 2333-6714
Launched : 2013
Annals of Forensic Research and Analysis
ISSN : 2378-9476
Launched : 2014
JSM Biochemistry and Molecular Biology
ISSN : 2333-7109
Launched : 2013
Annals of Breast Cancer Research
ISSN : 2641-7685
Launched : 2016
Annals of Gerontology and Geriatric Research
ISSN : 2378-9409
Launched : 2014
Journal of Sleep Medicine and Disorders
ISSN : 2379-0822
Launched : 2014
JSM Burns and Trauma
ISSN : 2475-9406
Launched : 2016
Chemical Engineering and Process Techniques
ISSN : 2333-6633
Launched : 2013
Annals of Clinical Cytology and Pathology
ISSN : 2475-9430
Launched : 2014
JSM Allergy and Asthma
ISSN : 2573-1254
Launched : 2016
Journal of Neurological Disorders and Stroke
ISSN : 2334-2307
Launched : 2013
Annals of Sports Medicine and Research
ISSN : 2379-0571
Launched : 2014
JSM Sexual Medicine
ISSN : 2578-3718
Launched : 2016
Annals of Vascular Medicine and Research
ISSN : 2378-9344
Launched : 2014
JSM Biotechnology and Biomedical Engineering
ISSN : 2333-7117
Launched : 2013
Journal of Hematology and Transfusion
ISSN : 2333-6684
Launched : 2013
JSM Environmental Science and Ecology
ISSN : 2333-7141
Launched : 2013
Journal of Cardiology and Clinical Research
ISSN : 2333-6676
Launched : 2013
JSM Nanotechnology and Nanomedicine
ISSN : 2334-1815
Launched : 2013
Journal of Ear, Nose and Throat Disorders
ISSN : 2475-9473
Launched : 2016
JSM Ophthalmology
ISSN : 2333-6447
Launched : 2013
Journal of Pharmacology and Clinical Toxicology
ISSN : 2333-7079
Launched : 2013
Annals of Psychiatry and Mental Health
ISSN : 2374-0124
Launched : 2013
Medical Journal of Obstetrics and Gynecology
ISSN : 2333-6439
Launched : 2013
Annals of Pediatrics and Child Health
ISSN : 2373-9312
Launched : 2013
JSM Clinical Pharmaceutics
ISSN : 2379-9498
Launched : 2014
JSM Foot and Ankle
ISSN : 2475-9112
Launched : 2016
JSM Alzheimer's Disease and Related Dementia
ISSN : 2378-9565
Launched : 2014
Journal of Addiction Medicine and Therapy
ISSN : 2333-665X
Launched : 2013
Journal of Veterinary Medicine and Research
ISSN : 2378-931X
Launched : 2013
Annals of Public Health and Research
ISSN : 2378-9328
Launched : 2014
Annals of Orthopedics and Rheumatology
ISSN : 2373-9290
Launched : 2013
Journal of Clinical Nephrology and Research
ISSN : 2379-0652
Launched : 2014
Annals of Community Medicine and Practice
ISSN : 2475-9465
Launched : 2014
Annals of Biometrics and Biostatistics
ISSN : 2374-0116
Launched : 2013
JSM Clinical Case Reports
ISSN : 2373-9819
Launched : 2013
Journal of Cancer Biology and Research
ISSN : 2373-9436
Launched : 2013
Journal of Surgery and Transplantation Science
ISSN : 2379-0911
Launched : 2013
Journal of Dermatology and Clinical Research
ISSN : 2373-9371
Launched : 2013
JSM Gastroenterology and Hepatology
ISSN : 2373-9487
Launched : 2013
Annals of Nursing and Practice
ISSN : 2379-9501
Launched : 2014
JSM Dentistry
ISSN : 2333-7133
Launched : 2013
Author Information X