Bovine babesios is a sporadic disease within the United Kingdom causing mortality and morbidity within the national herd. Despite numerous reports in cattle, there have been no published reports of its molecular characterization or genetic confirmation of the Babesia species since its first description in England. This study describes the molecular detection and species identification of Babesia divergens in a case of babesiosis from an outbreak of the disease on a farm in northern England. Phylogenetic analysis demonstrated that B. divergens 18S RNA sequence in England is 100% identical to B. divergens in Ireland and France. The sequence derived is publically available and can be used to compare future cases of bovine babesiosis, especially if the pathogenesis of disease changes in response to the emergence of other Babesia species.

•    Babesia divergens
•    Bovine babesiosis
•    Molecular detection
•    Phylogeny

Jizhou L, de Marco MF, Phipps PL, Macrelli M, Otter A, et al. (2017) Molecular Detection of Babesia divergens from an Outbreak of Babesiosis in Holstein Cows, England. J Vet Med Res 4(3): 1078.

B: Babesia; PCR: Polymerase Chain Reaction; UK: United Kingdom

Bovine babesiosis is a tick-borne protozoan infection that causes morbidity and mortality in cattle. The disease is characterized by fever, listlessness, and dehydration resulting from Haemolytic anaemia caused by the destruction of erythrocytes. This is evident in the red coloration in urine, hence the common name for the disease, red water. The most common Babesia species causing disease in Western Europe is Babesia divergens. Infections occur sporadically throughout Europe and may extend as far south as North Africa [1]. Its distribution is associated with that of its tick vector, Ixodesricinus. However, additional species that can infect cattle include B. major, B. bovis, B. bigemina, B. ovata, B. occultans and B.venatorum (formly babesia sp.EU1) [2]. Co-infection with B. divergens and Anaplasma phagocytophilum, the causative agent of tick-borne fever also transmitted by I. ricinus, appear to be very common, therefore blood samples from affected animals should be screened for both pathogens. In addition to infection in cattle, B. divergens is zoonotic with a number of documented cases reported across Europe in splenectomized individuals [1].

B. divergens was first described in England by McFadyean and Stockman [3], who named it Piroplasmida divergens. This initial study established that this species was morphologically distinct from the Babesia first described by Victor Babes and a babesia species detected in cattle in Devon [4] and now believed to be B. major [5]. Since this time B. divergens has been diagnosed in the United Kingdom (UK) by examination of Giemsa stained smears from cattle blood and size of the erythrocytic form of the parasite. A positive result is based on the presence of the trophozoite or merozoite forms of the parasite in erythrocytes and the length of the merozoite form has been used to distinguish different babesial species. Surprisingly, there have been no published reports of molecular characterisation of B. divergens in cattle from England or publically available DNA sequence from English derived cases. The only report from the UK is a fatal case of babesiosis in a reindeer (Rangifer tarandustarandus) where a fragment of 18S ribosomal RNA gene was used to confirm the infecting organism [6]. A recent report has also used molecular methods to detect B. divergens in I. ricinus removed from a domestic dog [7]. There are B. divergens sequences from bovine babesiosis cases in Ireland where the incidence of clinical babesiosis is monitored and have been shown to be in decline [8]. In order to address this we have used molecular methods that have been applied to the detection of Babesias and Theilerias in England [9,10,11] to confirm infection with B. divergens in a recently described case of bovine babesiosis from a farm in England [12].

DNA was extracted from 100 µl of EDTA treated blood taken from the first cow using the DN easy Blood and Tissue Kit (QIAgen, Manchester, UK) following the manufacturer’s instructions. Babesia parasites were detected using a pan-piroplasm PCR that amplifies a partial (423 base pair) fragment of the 18S ribosomal gene using primers PIRO-A (AATACCCAATCCTGACACAGGG) and PIRO-B (TTAAATACGAATGCCCCCAAC) [13]. Amplified products were sequenced using flanking primers and derived sequence edited in Laser gene version 12.1 (DNASTAR) and assigned to a particular species based on BLAST (NCBI) search, when agreement was ≥ 98 % to sequences of known Babesia species in GenBank. Once identification was achieved, Neighbour-joining analysis was conducted using I MEGAv.6 [14]. Bootstrap values were calculated to test the robustness of the cluster using 1000 pseudoreplicates. Values greater than 70% were considered significant.

In September of 2016, a pregnant female Holstein cow collapsed. A subsequent veterinary inspection suggested milk fever (hypocalcaemia) with a temperature of 37.2o C and the cow was treated with calcium intravenously. It subsequently gave birth to a still-born calf and shortly afterwards began to spasm and exhibited behavior including leg paddling and eye rolling. The legs became hyper-extended and the cow died shortly afterwards. A blood sample was taken from the animal. The sample haemolysed within the tube and had a packed cell volume (PCV) of 4% (normal range for cattle 24-48%). The animal tested negative for A. phagocytophilumby polymerase chain reaction (PCR), and haematological examination of Giemsa-stained blood smear identified red blood cell inclusions as being consistent with Babesia infection. Based on this, a diagnosis of babesiosis was made and attributed to infection with B. divergens. During September ten cows from a total of 120 cattle on the property were affected. A second cow was also confirmed positive for babesiosis by blood smear. Of the affected cows three aborted despite preventative treatment with Imizol® following the manufacturer’s recommendations, and two died, including the case above. According to the owner, the herd had been grazed on tick infested land and ticks were regularly reported on the cattle during milking. However, the most recent cases of red water fever were reported four years previously.

Pan-piroplasm PCR successfully amplified a fragment of the correct size from DNA extracted from a blood sample obtained from the cow (Figure 1). The amplicon was sequenced to generate 364 base pairs with 100% identity to B. divergens from isolates derived from a number of European countries. Phylogenetic comparison with a range of B. divergens sequences from Scotland, Ireland and France confirmed the species designation and demonstrated that it was distinct from other small Babesia species (Figure 2). The sequence has been submitted to GenBank with accession number KY296360.

Numerous tests have been developed for diagnostic as well as epidemiological investigation of babesiosis in livestock. In Great Britain, the main approach is to match clinical evidence with detection of the parasite in stained blood smears [15]. Alternatively, serological detection is used such as Babesiaspecific immunofluorescence antibody tests (IFAT). Babesia divergens was first described by McFadyean and Stockman [3] based on the morphology of the merozoite form, with dimensions of 1.5 - 2.0 by 0.4µm, leading to its designation as a small Babesia species. This has meant that past detection of babesia have been based purely on morphometric methods leading to uncertainty over the precise species designation [16,17]. However, more than 100 species of Babesia have been described [18], some of which are present in the UK tick population [7] and have a similar morphology during the erythrocytic stage of infection in their primary mammalian host. Also large Babesia species have been detected in the UK such as B. major [19] and B. motasi [10] that can infect livestock. A further issue has been the dearth of research activity on UK-endemic piroplasms since the 1980s.

B. divergens has been detected in English livestock for over 100 years although this is the first time that the infecting species has been confirmed by molecular methods. The tick vector, Ixodesricinus is present across the country although disease is associated with areas of high tick abundance. There is evidence for endemic stability in livestock [20] and in the UK this is manifest as occasional outbreaks of bovine babesiosis when immunologically naïve adult cattle are moved onto fields where infected ticks are present. This is likely to be the case in the cattle herd reported in this study. The application of piroplasm PCR-sequencing offers the opportunity to both detect and identify species of Babesia in cases of haemolytic anaemia in cattle and other livestock [21]. Further study is required to assess the sensitivity of this approach and its ability to detect both acute piroplasm infection and carrier status of British livestock.

This study was funded by the Department of Environment, Food and Rural Affairs (DEFRA), Scottish and Welsh Government through projects ED1036 and SV3045.

1. Zintl A, Mulcahy G, Skerrett HE, Taylor SM, Gray JS. Babesia divergens, a bovine blood parasite of veterinary and zoonotic importance. Clinical Microbiology Rev. 2003; 16: 622-636.

2. Bock R, Jackson L, de Vos A, Jorgensen W. Babesiosis of cattle. Parasitol. 2004; 129: S247-S269.

3. McFadyean J, Stockman S. A new species of piroplasm found in the blood of British cattle. J Comp Pathol. 1911; 24: 340-354.

4. Thorburn EJ. Bovine malaria – red water. Vet Rec. 1902; 15: 171.

5. Purnell RE. Tick-borne diseases of British Livestock. Vet Med Rev. 1981; 1: 58-69.

6. Langton C, Gray JS, Waters PF, Holman SJ. Naturally acquired babesiosis in a reindeer (Rangifer tarandus tarandus) herd in Great Britain. Parasitol Res. 2003; 89: 194-198.

7. Smith FD, Wall LE. Prevalence of Babesia and Anaplasma in ticks infesting dogs in Great Britain. Vet Parasitol. 2013; 198: 18-23.

8. Zintl A, McGrath G, O’Grady L, Fanning J, Downing K, Roche D, et al. Changing incidence of bovine babesiosis in Ireland. Irish Vet J. 2014; 67: 19.

9. Johnson N, Goharriz H, Phipps PR, Wakeley PR. Babesiavogeli in a quarantined dog. Vet Rec. 2013; 172: 241-242.

10. Phipps LP, Hernández-Triana LM, Goharriz G, Welchman D, Johnson N. Detection of Theilerialuwenshuni in sheep from Great Britain. Parasit Vectors. 2016; 9: 203.

11. Fernández de Marco M, Brugman VA, Hernandez-Triana LM, Thorne L, Phipps LP, Nikolova NI, et al. Detection of Theilerialuwenshuni in mosquito blood meals in the United Kingdom. Vet Parasitol. 2016; 229: 31-36.

12. Anonymous. Disease surveillance in England and Wales, October 2016. Vet Rec. 2016; 179: 455-458.

13. Brugman VA, Hernández-Triana LM, Prosser SW, Weland C, Westcott DG, Anthony R. Fooks, et al. Molecular species identification, host preference and detection of Myxoma virus in the Anopheles maculipennis complex (Diptera: Culicidae) in southern England, UK. Parasit Vectors. 2015; 8: 421.

14. Tamura K, Stecher G, Petersen D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol. 2013; 30: 2725-2729.

15. Donelly J, Crossman PJ, McKendrick MD. An outbreak of redwater on a farm in Sussex. Vet Rec. 1970; 87: 23.

16. Lewis D, Holman MR, Purnell RE, Young ER, Herbert IV, Bevan WJ. Investigations on Babesia motasi isolated from Wales. Res Vet Sci. 1981; 31: 239-243.

17. Purnell RE, Lewis D, Holman MR, Young ER. Investigations on a Babesia isolated from Scottish sheep. Parasitol. 1981; 83: 347-356.

18. Schnittger L, Rodriguez AE, Florin-Christensen M, Morrison DA. Babesia: a world emerging. Infect Genet Evol. 2012; 12: 1788-1809. 19.Brocklesby DW, Sellwood SA. Babesia major in Britain: Tick transmitted infections in splenectomised calves. Res Vet Sci. 1973; 14: 47-52.

20. Penzorn BL. Babesiosis of wild carnivores and ungulates. Vet Parasitol. 2006; 138: 11-21.

21. Lempereur L, Beck R, Fonseca I, Marques C, Duarte A, Santos M, et al. Guidelines for the detection of Babesia and Theileria parasites. Vector Borne Zoonotic Dis. 2017; 17: 51-65.