Molecular and Serological Detection of Tick-Borne Hemopathogensamong Stray Dogs in East Malaysia
- 1. Department of Companion Animal Medicine and Surgery, Faculty of Veterinary Medicine, Universiti Putra Malaysia
- 2. Department of Veterinary Laboratory Diagnostics, Faculty of Veterinary Medicine, Universiti Putra Malaysia
- 3. Department of Veterinary Clinical Studies, Faculty of Veterinary Medicine, Universiti Putra Malaysia
- 4. Department of Veterinary Parasitology and Entomology, University of Maiduguri, Nigeria
Abstract
The current study focused on some of the most important common tick-borne hemopathogens of dogs in East Malaysian region with the aim of providing information regarding their prevalence and distribution among sex, age and breed. Blood samples were collected from 104 clinically healthy dogs, randomly selected from animal shelters located within Sarawak (50) and Sabah (54). Total DNA was extracted from blood samples and amplified by polymerase chain reaction (PCR) for the detection of Ehrlichia, Anaplasma, Babesia and Hepatozoon species. Of the samples tested, 86.5% were infected with at least one of the four hemopathogens; of which Babesia pp. predominated with a prevalence of 65.4%, followed by Ehrlichia canis, Anaplasma platys and Hepatozoon canis with prevalence rates of 47.1%, 38.5% and 28.8% respectively. The prevalence rates of Babesia spp. and Ehrlichia canis were significantly (p<0.05) higher in Sarawak compared to Sabah (p = 0.001 each). Male dogs showed a significantly (p < 0.05) higher E. canis infection rate than their female counterparts and adult dogs had a higher infection rate than younger dogs. There was no significant difference among sex, age and breed for the other hemopathogens. Coinfections were common and most dogs were infected with at least two pathogens (44.2%). Babesia spp and E. canis were most often seen to co-infect (35.6%). The study revealed high molecular and serological prevalence of tick-borne hemopathogens as well as mixed infections among stray dogs in East Malaysia.
Keywords
• Serology
• Molecular
• Tick-borne hemopathogens
• Co-infections
• Stray dogs
• East Malaysia
Citation
Mohammed K, Tukur SM, Watanabe M, Abd Rani PAM, Sharma RSK, et al. (2017) Molecular and Serological Detection of Tick-Borne Hemopathogensamong Stray Dogs in East Malayysia. J Vet Med Res 4(2): 1074.
INTRODUCTION
Tick-borne diseases are a problem worldwide, especially in the warm humid climates of the tropics and subtropics [1-6]. The humid warm climatic conditions of the tropics favour the growth and proliferation of tick vectors and other reservoir hosts, at the same time shortening their generation interval over time [7-9]. Some common tick-borne hemopathogens of veterinary significance in tropical regions include Babesia, Hepatozoon, Ehrlichia and Anaplasma species [10-14]. Clinically, they are the most significant hemopathogens of dogs and are associated with varying severity of clinical signs and a major health concern to dogs [15,16]. An increase in the stray dog population poses a potential threat to the naïve dog population as they may act as reservoirs of infection [17].
Despite an increase in the stray dog population in the area, coupled with the abundance of reservoir hosts and favourable climatic conditions for the survival of both the ticks and their reservoirs in the region; there is relatively low awareness regarding tick-borne disease among dog owners in the area. No information could be obtained regarding the prevalence of tickborne pathogens of dogs in East Malaysia. Hence, this study was designed to determine the prevalence of some common tickborne hemopathogens of dogs in the study area using serology and PCR and establish their co-infectivity status
MATERIALS AND METHODS
Ethics statement
Approval was obtained from the Institutional Animal Care and Use Committee Universiti Putra Malaysia (IACUC) (Approval code: R074/2013). Consent was obtained from the shelters prior to sampling.
Sampling
A total of 104 stray dogs of different sex, breed and age were randomly sampled from animal shelters in Sabah and Sarawak between May 2013 and June 2014 (Figure 1). The age groups were stratified into young (0 - 12 months of age) and adult (12 months and above), while the breeds were broadly classified into local and pedigree. Three ml of blood was drawn from the cephalic vein out of which 1ml was aliquoted into ethylene diamine tetra acetic acid (EDTA) tubes for microscopy and PCR, and the remaining 2ml was aliquoted into plain tubes for serology
Sampling site
Sampling was carried out in Kuching, Sarawak and Kota Kinabalu, Sabah, East Malaysia (Figure 1).
Sampling sites inclusion criteria
The animal shelters must have had a population of more than 100 dogs at the point of sampling, no recent treatment against tick-borne pathogens should have been carried out, they must have adequate records concerning the source, treatment and management status of the dogs in the shelter and the shelters must cater for dogs from a large perimeter across the state.
Animal inclusion criteria
Dogs from the quarantine units of the shelters were used for this study, because they were newly brought-in with no treatment against any ectoparasites or diseases by the animal shelter prior to sample collection. Therefore, the dogs screened in the study were stray dogs for a range of 3 to 4 weeks before initiation of the study.
DNA extraction and PCR amplification
DNA was extracted from whole blood (200 µl) following theQIAamp blood and tissue kit protocol (QIAGEN GmbH, Hilden, Germany) and stored at -200 C for further use. Initially, all DNA samples were screened by PCR amplification for the presence of pathogens’ DNA at genus level using genus-specific primers (Table 1). Positive samples were then further screened using species-specific primers (Table 1). PCR amplification was carried out in final volumes of 25 ml reaction mixtures containing 4µl of DNA template, 5µl of25X buffer without MgCl2, 1µl of10mM dNTP, 5µl of25X MgCl2, 1µl of 20pmol of each primer [18-22], 1.5U of Taq polymerase and 7.7µl of sterile distilled water. PCR was carried out in a thermal cycler (BioRad, MyCyclerR USA) with the cycling conditions indicated in Table 2. The amplified products were electrophoresed on a 1.5% - 2% agarose gel (depending on the size of the PCR product) Positive controls were obtained from our previous work confirmed via sequencing. After electrophoresis the gels were stained with ethidium bromide and visualized under a UV transilluminator (BioRadAlpaImagerR, USA).
Serological analysis
The SNAP® 4DX® PLUS in-vitro serological diagnostic test was employed for the detection of antibodies to Anaplasma phagocytophillum, A. platys, Ehrlichia canis and E. ewingii inserum samples. All test procedures and interpretation of results were conducted according to the manufacturer’s specifications contained in the user manual’s guide (IDEXX Laboratories, Inc.).
NB: As indicated by the manufacturer, the test procedure cannot differentiate between the results of A. phagocytophillumand A. platys. Which means a positive result simply indicates the presence of antibodies to A. phagocytophilum and / or A. platys. The same applies for E. canis and/ or E. ewingii. Serological detection of Babesia and Hepatozoon spp. was not conducted in this study.
Sequencing
Amplicons obtained from the PCR reactions were extracted using the Wizard® SV Gel and PCR Clean-Up System purification kit (Promega, USA) for direct sequence analysis using ABI prismTM BigdyeTM terminator cycle sequencing Ready reaction kit V.3.1. All sequences were aligned manually using the ClustalWprogram ww.ebi.ac.uk/clustalw). Sequences obtained were compared with thoseavailable in GenBank using the BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
Statistical analysis
Statistical analyses were performed using the Statistical Package for the Social Sciences version 20.0 (SPSS Inc., Chicago, IL). Relation between categorical outcomes, i.e. absence or presence of specific infection, gender and age were compared using the chi-square test and the Fisher’s exact test was employed for age and breed.Differences between sampling locations and parasites prevalence rates were analysed at 95% confidence interval. Statistical significancewas set at p ≤ 0.05.
Table 1: Primer sets used for PCR amplification.
Target sequence | Primer sequence (5’ - 3’) | Length (bp) |
References |
Anaplasmataceae 16S rRNA |
fD1 5’AGAGTTTGATCCTGGCTCAG 3’ Rp2 5’ ACGGCTACCTTGTTACGACTT 3’ |
350bp | [22] |
Ehrlichiacanis 16S rRNA |
CANIS 5’ CAATTATTTATAGCCTCTGGCTATAGGA 3’ GA1UR 5’ GAGTTTGCCGGGACTTCTTCT 3’ |
409bp | [22] |
Anaplasma platys 16S rRNA |
PlatysF 5’ AAGTCGAACGGATTTTTGTC 3’ PlatysR 5’ CTTTAACTTACCGAACC 3’ |
500bp | [23] |
Babesiadae 18S rRNA |
BT-F1 5’ GGTTGATCCTGCCAGTAGT 3’ BT-R1 5’ GCCTGCTGCCTTCCTTA 3’ |
350bp | [24] |
Babesiavogel 18S rRNA |
C172F 5’ GTTTATTAGTTTGAAACCCGC 3’ C626R 5’ GAACTCGAAAAAGCCAAACGA 3’ |
450bp | [25] |
Babesia gibsoni 18S rRNA |
Gib599F5’ CTCGGCTACTTGCCTTGTC 3’ Gib1270R5’ GCCGAAACTGAAATAACGGC 3 |
690bp | [25] |
Hepatozooncanis 18S rRNA |
HEPF 5’ ATACATGAGCAAAATCTCAAC 3’ HEPR 5’ CTTATTATTCCATGCTGCAG 3’ |
696bp | [26] |
Table 2: Thermal cycling parameters for each pathogen An initial denaturation was set at 950 C for 5min, the denaturation cycle was set at 950 C for 30sec, a final extension at 720 C for 5min and holding at 100 C were set for all pathogens.
Pathogen | Annealing T0C | Extension T0C | Number of cycles |
Anaplasmataceae | 62 for 30sec | 72 for 1min30sec | 40 cycles |
A. platys | 64.5 for 30sec | 72 for 1min | 40 cycles |
Babesia genus | 64 for 30sec | 72 for 1min | 40 cycles |
B. vogeli | 57.5 for 30sec | 72 for 1min | 40 cycles |
B. gibsoni | 62 for 30sec | 72 for 1min | 40 cycles |
E. canis | 60 for 30sec | 72 for 1min30sec | 40 cycles |
H. canis | 60 for 30sec | 72 for 1min30sec | 40 cycles |
RESULTS
The results of this investigation showed that 86.5% of the stray dog population sampled were infected with at least one of the four hemopathogens identified, with the genus Babesia predominating (65.4%), followed by E. canis (47.1% for PCR and 56.7% for serology) and Anaplasma platys (38.5% for PCR and 31.7% for serology); while Hepatozooncanis recorded the least prevalence of 28.8% (Table 3). However, demographic distribution of the individual pathogens among stray dogs between the two states (Sarawak and Sabah) showed that Anaplasma platys predominated (46.3%) in Sabah, while Babesia vogeli predominated in Sabah (92.9%). Significant (p 0.05) were found among sex, age and breed for the hemopathogens using both PCR and serology in the area (Table 5).
Co-infection status among stray dogs for the various hemopathogens in the study area showed that 44.2% were harbouring two hemopathogens concurrently. Further analysis to investigate which of the two hemopathogens concurrently infects the dogs revealed that Babesia spp. and E. canis were most often seen to co-infect (Table 6).
DISCUSSION
To the best of our knowledge, this study was the first to report the prevalence of tick-borne hemopathogens of dogs in East Malaysia, using both molecular and serological techniques for detection.
The current study was strictly conducted on rescued stray dogs from various animal shelters and dog pounds within the study area and the results of this investigation cannot be applied to the general dog population in the area, however the high prevalence rates of the various hemopathogens is of concern as the stray dogs are a constant reservoirs of infection. This is worrying especially as East Malaysia is less developed compared to West Malaysia and veterinary care is not readily available for dog owners. The reason for the high Babesia spp. and E. canis prevalence rates compared to other hemopathogens and between the two states could not be fully ascertained.
In contrast to the high prevalence among dogs infected with two hemopathogens simultaneously, only 5.8% of the total population was infected with all four hemopathogens. This finding might be due to the vectoral capacity of a common tick-vector (like Rhipicephalus sanguineus and Haemaphysallis spp.) in transmitting all the four hemopathogens [23,24]. At this point in time, no conclusions can be made concerning the relationship between Babesia and Ehrlichia spp for being the two most commonly related hemopathogens in terms of co-infection. However, the results of this study serve as an important reminder for veterinarians to be aware of the possibility of mixed infections. As this study was the first of its kind to investigate canine tick-borne hemopathogens in Sabah and Sarawak, the need to further investigate and characterize the different strains of these hemopathogens for a better understanding of their epidemiology is paramount. At the same time it necessitates a conscientious effort to further investigate other pathogens of possible zoonotic significance [25-27] in order to provide adequate information on the zoo epidemiology or epizootiology of these hemopathogens.
Table 3: Prevalence of tick-borne hemopathogens identified from stray dogs in East Malaysia.
Pathogen | PCR | Serology | ||
Frequency (n = 104) | Prevalence (%) | Frequency (n = 104) | Prevalence (%) | |
A. platys | 40 | 38.5 | 33 | 31.7 |
E. canis | 49 | 47.1 | 59 | 56.7 |
Babesia spp. | 68 | 65.4 | - | - |
H. canis | 30 | 28.8 | - |
Table 4: Demographic/Prevalence and distribution of tick-borne hemopathogens in dogs identified from Sabah and Sarawak, Malaysia.
Pathogen | PCR | Serology | ||||
Frequency Sabah/ Sarawak (n = 54 / 50) |
Prevalence (%) | p-value | Frequency Sabah/ Sarawak |
Prevalence (%) | p-value | |
A. platys | 25/15 | 46.3a/30.0a | 0.088 | 16/17 | 29.6/34.0 | 0.394 |
E. canis | 15/34 | 27.8a/68.0b | 0.001 | 32/37 | 59.54.0 | 0.366 |
Babesia spp. | 26/42 | 48.1a/84.0b | 0.001 | - | - | - |
H. canis | 20/10 | 37.0a/20.0a | 0.055 | - | - | - |
NB: Row values with different superscript between comparative groups (Sabah / Sarawak) are statistically significant (p≤0.05). n = 54 for Sabah and n = 50 for Sarawak. |
Table 5: Age, sex and breed-wise prevalence of the various hemopathogens in stray dogs in East Malaysia.
Factor Category | Frequency (n = 104) |
PCR / Serological Prevalence (%) | ||
Anaplasma spp | Ehrlichiaspp.H. | canisBabesia spp. | ||
Sex: | ||||
Male | 45 | 16(35.6)/17(37.8) | 28(62.2)a /27(60.0) | 13(28.9) / - 26(57.8) / - |
Female | 59 | 24(40.7)/16(27.1) | 21(35.6)b /32(54.2) | 17(28.8) / - 42(71.2) / - |
Age: | ||||
Young | 20 | 9(45)/2(10)a | 1(5)a /3(15)a | 8(40) / - 12(60) / - |
Adult | 84 | 31(36.9)/31(36.9)b | 48(57.1)a /56(66.7)b | 22(26.2) / - 56(66.7) / - |
Breed: | ||||
Local | 87 | 33(37.9)/30(34.5) | 48(55.2)/50(57.5) | 22(25.3) / - 57(65.5)/ - |
Pedigree | 17 | 7(41.2)/3(17.6) | 1(5.9)/9(52.9) | 8(47.1) / - 11(64.7) / - |
NB: Row values with different superscript between comparative groups (eg. Male and female) are statistically significant (p≤0.05) for each of the diagnostic tests. |
Table 6: Mixed infections among dogs in East Malaysia
Pathogen | Frequency (n = 104) |
Prevalence (%) |
No infection | 14 | 13.5 |
Single infection | 22 | 21.2 |
Co-infections | 46 | 44.2 |
Mixed infection | 16 | 15.4 |
(3 pathogens) | ||
Mixed infection | 6 | 5.8 |
(4 pathogens) |
CONCLUSION
In conclusion, this study confirmed for the first time, the presence of tick-borne hemopathogens (Anaplasma platys, Ehrlichia canis, Babesia vogeli, Babesia gibsoni and Hepatozoon canis) in Sarawak and Sabah States of East Malaysia. Babesia spp. predominated as the most common hemopathogen in both the two States of East Malaysia. Age and sex affects the prevalence of Ehrlichia canis and Anaplasma platys. The presence of mixed infection was also established.
ACKNOWLEDGEMENTS
The research was supported in part by the Universiti Putra Malaysia, Research University Grant Scheme (Project no: 01-01- 09-0662RU). The SNAP 4Dx kits were sponsored by ArachemSdn Bhd. Our profound gratitude to Dr. Randolf from Sabah and Dr. Davies Banda from Sarawak, who helped link us with the management of the animal shelters, at the same time serving as our guide during sampling in Sabah and Sarawak respectively. We are most grateful tothe technical staff of the parasitology laboratory for providing all the necessary assistance during the course of this research.