Myostatin Modulates the Heart Rate in Zebrafish Embryos
- 1. Centro de Investigación en Alimentación y Desarrollo (CIAD), Avenida Sábalo Cerritos s/n, Mexico
- 2. Departamento de Neurobiología Celular y Molecular, Universidad Nacional Autónoma de México, Mexico
- 3. Centro de Investigación en Alimentación y Desarrollo (CIAD), Avenida Sábalo Cerritos s/n, Mazatlán, Mexic
Abstract
Myostatin, a negative regulator of skeletal muscle growth, is also expressed in cardiac muscle; however its function in this tissue is poorly understood. In this study, the CRISPR/Cas9 system was used to inactivate mstn in zebrafish. Microinjection was performed in one-cell stage embryos, and genomic DNA sequencing analysis confirmed high mutation efficiency. Coronal histological sections from 5 days post-fertilization (dpf) larvae showed the expected phenotype of skeletal muscle growth, but no evident morphological alterations were observed in the heart. An examination of 2 dpf embryos revealed a significant decrease in the heart rate, suggesting that mstn could play a role in cardiac function during development.
Citation
Lizárraga-Lizárraga D, Martínez-Torres A, Llera-Herrera R, Espino-Saldaña ÁE, García-Gasca A (2017) Myostatin Modulates the Heart Rate in Zebrafish Embryos. JSM Biotechnol Bioeng 4(1): 1077.
Keywords
• Myostatin
• Heart rate
• Zebrafish
• CRISPR/Cas9
• Muscle growth
• Embryo
ABBREVIATIONS
mstn: Myostatin; dpf: Days post-fertilisation; PAM: Protospacer Adjacent Motif; NGS: Next Generation Sequencing
INTRODUCTION
Myostatin is a negative regulator of skeletal muscle growth [1]. In mammals, it is expressed in skeletal [2,3], cardiac [4], and smooth muscle [5]. The role of myostatin in cardiac muscle has not been completely elucidated [4,6-9]. Nevertheless, it has been observed that cardiac myostatin is induced during heart failure in different mammalian models producing skeletal muscle wasting [10,11], and that cardiac function improves in aging knockout mice [7], suggesting, on one hand, an inverse association between myostatin induction and heart performance and, on the other hand, a therapeutic potential of myostatin inactivation to improve cardiac function and alleviate skeletal muscle cachexia under aging or heart failure conditions.
In zebrafish, mstn is expressed in several organs such as gill, brain, eye, and heart [12], however its function has only been characterized in skeletal muscle using different approaches. For instance, a transgenic line expressing the mstn prodomain driven by the light chain myosin (mylc) promoter showed hyperplasia of muscle fibres [13]. Later, dsRNA was used to target the active peptide region, obtaining the double muscle phenotype [14]. Also, a vector-based antisense RNA was used to silence mstn [15] resulting in hypertrophy and hyperplasia in skeletal muscle, as well as increased expression levels of myogenic factors. Here, in order to study mstn function in cardiac muscle, the CRISPR/Cas9 nuclease system [16,17] was used to inactivate mstn in zebrafish.
MATERIALS AND METHODS
Construction of the CRISPR/Cas9 system and microinjection
A hybrid strain of zebrafish brood stock (TAB-WIK) was maintained in a re-circulating system. Embryos were obtained and raised according to [18,19].
The target sequence was designed from exon 3 (GenBank accession no. AY323521.1), corresponding to the sequence encoding the active peptide. The gRNA was synthesized according to [20]. Two partially overlapping oligonucleotides were designed to produce the template to synthesize the gRNA. Oligonucleotide 1 consisted of a T7 promoter (bold), the PAM site (underlined), 20 nucleotides corresponding to the target sequence (in parenthesis) and a generic gRNA sequence:
5 - T A A T A C G A C T C A C T A T A - N G G - (AGGGCCCAAAACGAATCCGG)-GTTTTAGAGCTAGAAATAGC-3’
Oligonucleotide 1 was annealed with oligonucleotide 2, which consisted of 80 nucleotides overlapping the generic gRNA sequence in oligonucleotide 1:
5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTA TTTTAACTTGCTATTTCTAGCTCTAAAAC3
Both oligonucleotides were annealed in the overlapping regions (represented in italics) and the 3’-ends were extended using Pfu polymerase under the following conditions: 98° C 2 min, 50° C 10 min, and 72° C 10 min. The resulting double stranded DNA was used as template for in vitro transcription of the gRNA using the HiScribe T7 kit (New England Biolabs), following the manufacturer’s instructions.
To synthesize the Cas9 mRNA, a pT3TS-nCas9n plasmid was obtained from Addgene (plasmid #46757), and was processed according to the CRISPR plasmid protocol from [21]. The plasmid was linearized and used as template for in vitro transcription of the Cas9 mRNA using the mMESSAGEmMACHINE T3® kit (Ambion) following the instructions provided by the manufacturer.
The injection mix consisted of gRNA, Cas9 mRNA, phenol red (final concentration 0.01%), and nuclease-free water. Experimental groups were separated as follows: embryos injected with myostatingRNA (mstn, n=158), embryos injected with the mix without gRNA (n=43), and non-injected embryos (n=38). The mix was injected to each embryo using a PV 820 Pneumatic PicoPump (World Precision Instruments) microinjector.
Heart rate recording and sampling
The heartbeat of embryos at 2 dpf was recorded for 30 seconds using as CMOSpco. Edge high resolution video camera coupled to an Olympus BX51WI microscope with a magnification of 20X. At this stage the cardiovascular system is developed, embryos are transparent, static and easy to handle. At 5 dpf fish were anesthetized with 4% MESAB (MS-222) for sampling. The posterior region was preserved in absolute ethanol for DNA extraction [22] and the anterior region was preserved in 4% formalin for histology.
Histological analysis
Serial coronal sections were obtained from 5 dpf larvae, and stained with haematoxylin-eosin. The area of five muscle fibres per larvae were captured (Qimaging Micro Publisher coupled to an Olympus CX41 light microscope) and measured (SigmaScanPro 5.0 software). The heart was carefully observed looking for morphological differences between mutant and normal fish.
Genotyping by NGS
The region containing the target sequence was amplified us ing the Zf-mst1-F and Zf-mst1-R primers rendering a product of about 900 bp (Table 1, Figure 1). Then nested PCR reactions were performed using a set of four M13 forward primers, each one with a different barcode: M13-1-Zf_mst1-F to M13-4-Zf_mst1-F, and one M13 reverse primer (M13 - Zf_mst1-R), rendering a product of about 100 bp (Table 1, Figure 1). Final PCR reactions were carried out using IonXpress with different barcode sequences; the reverse primer was RVS for all reactions (Table 2, Figure 1).
Once the three PCR reactions were completed, all samples were pooled together and purified using the Wizard® SV Gel and PCR Clean-Up System (Promega), followed by an additional step with AMPure-XP® paramagnetic beads (Beckman Coulter). These barcode libraries were sequenced using a 316 chip and the Hi-Q sequencing chemistry on the Ion Torrent PGM (Thermo Fisher Scientific). The sequencing reads were retrieved as FASTQ and demultiplexed based on the combinatorial barcodes in both IonXpress and M13-Zf-mst-1 primers used in the third and second PCRs, respectively. A strict quality-filter of Q < 20 (Phred score) in any position was then applied, obtaining an average of 341 clean reads per individual. Sequences from each individual were transformed to FASTA, aligned against the wild type reference sequence and compared.
RESULTS AND DISCUSSION
Mortality was 80% for the mstn group, 35% for the injected control group, and 5% for the non-injected control group indicating that some mortality was due to both the microinjection and the mutation. The mutation success was 90.6%. From the 29 mutant fish, a total of 9024 sequences were analysed, with an average of 334 sequences per individual. Mutations were classified into different types, depending on the number of inserted or deleted nucleotides (Figure 2). Indel range was consistent with previous reports using the CRISPR/Cas9 nuclease system in zebrafish [21].
Significant differences in skeletal muscle fibre area were observed in 5 dpf larvae as shown in (Figure 3A, 3B) (Kluskal-Wallis analysis of variance followed by paired Dunn comparisons; P < 0.001). This phenotype is consistent with previous reports [13- 15], confirming that the inactivation of mstn was successful. No evident histological alterations between mutant and control larvae were observed in the heart (Figure 3C). Nevertheless, the mutation did produce a reduction in the heart rate. The number of heart beats per minute in 2 dpf embryos are shown in Figure (4). Significant differences were found between mutant and control embryos (Kluskal-Wallis analysis of variance followed by paired Dunn comparisons; P < 0.001).
Results regarding the role of myostatin in heart size and ventricular hypertrophy using mouse models are scarce and contradictory [4,6-9]. Interestingly, a significant decrease of systolic contractions in mstn-null mice in resting state has been reported [4]. This is important because de inhibition of mstn seems to improve heart performance in aging mammalian models [7] prob- ably by reducing systolic contractions. Consistent with these observations, mstn-mutant zebrafish embryos presented a reduced cardiac beat rate in resting state, suggesting a role for myostatin as a modulator of cardiac function not only under heart failure or aging situations, but also during development.
CONCLUSION
Genomic edition of mstn in zebrafish embryos resulted in a significant reduction in the heart rate, suggesting that mstn could play a role in the regulation of cardiac contractions during embryonic development.
ACKNOWLEDGEMENTS
The authors would like to thank the Laboratory of Cellular and Molecular Neurobiology (UNAM) for microinjection facilities. Thanks to Rubí Hernandez-Cornejo for technical assistance; to Bruno Gómez-Gil and JulissaEnciso for barcode-library sequencing; to ItzelSifuentes-Romero, Juan Manuel Martínez-Brown, and Cristina Chávez-Sánchez for constructive comments to this work. This work was supported by the National Council for Science and Technology (CONACYT) (grant CB-179098).
