ndoleamine 2,3-dioxygenase; Age related cataracts; UV filters; Variants

Indoleamine 2, 3–dioxygenase (IDO), a heme containing enzyme catalyzes the first and rate limiting step of tryptophan (trp) catabolism along the kynurenine (kyn) pathway. IDO plays a role in peripheral immune tolerance, and also regulates homeostasis by preventing autoimmunity or immunopathology that occurs due to uncontrolled and overreacting immune responses. IDO is also involved in the protection of fetal allograft, engraftment of skin and organ transplantation [1-4]. Pathophysiological role of IDO has been identified in cancers [5,6] and also in some neurological disorders like Alzheimer’s and Parkinson’s diseases [7-10].

The presence of UV filters in the lens of human eye establishes the role of IDO in the development of age-related cataracts (ARCs). Kyn and its derivatives like 3OHKyn and 3OHKG (3-hydroxy kynuranine glucoside) generated in kyn pathway by the catabolism of trpact as UV filters [11-13], that are capable of protecting lens from UV damage when they are free in solution. With ageing, the levels of free UV filters get decreased and they can covalently bind to lenticular proteins leading to the accumulation of protein adducts in the lens, resulting in lens opacification [11,15,16]

IDO enzyme is encoded by a gene IDO, which has been evolved due to gene duplication of a more ancient protoIDO gene before the divergence of marsupial and eutherian mammals. IDO (OMIM No.147435) is a single copy gene located on chromosome 8p12-11 comprising 10 exons spanning 15 kb and codes for a protein of 403 amino acids with a molecular weight of 45,332 daltons. Sequence variations of IDO gene are recorded in NCBI data base. About 18 variants were identified in exons and exon-intronic boundaries of human IDO gene have not shown clinical significance except those variants identified in the study conducted by us which highlighted the association of IDO variants with Age Related Cataracts (ARCs). The 1.3kb upstream region of IDO gene denotes its promoter which harbors different regulatory sequences which include three gamma activation sequences (GAS) and two interferon stimulated response elements (ISRE) [17,18]. So far, very few studies are carried out on IDO genetic variants and their functional significance [19-23], but did not reveal association with any condition.

Till date studies are conducted only explaining the pathological role of quantitative levels of IDO and its catabolites in developing different conditions like cancers, Alzheimer’s and Parkinson’s diseases but are not extended to correlate with molecular alterations. We have analyzed for the first time the association of IDO gene and its promoter variants with different types of ARCs viz. Nuclear Cataract (NC); Cortical Cataract (CC) and Posterior Sub- capsular cataract (PSC).

In the present study, 331 age related cataract patients registered for surgery at Sarojini Devi Eye Hospital and institute of ophthalmology, Hyderabad and 210 healthy normal individuals for comparison with patients were investigated to evaluate the contribution of IDO gene variation for developing lens opacity. All the patients studied had primary cataract cases without any associated conditions like diabetes, hypertension, myopia, thyroid disorder, trauma etc. They were categorized into 3 groups based on LOC-III classification system [24], as Nuclear cataract (NC), Cortical cataract (CC) and Posterior Polar cataract (PSC). Control subjects were selected at random by personal contacts, of the employees of government and private organizations with the provision for annual health check up. All the controls were without the history of cataract, diabetes, hypertension and other ocular diseases. Clinical and family details etc., were recorded from patients and controls in a specified proforma and approval for the study was obtained from institutional ethical committee following the Helsinki declaration.

EDTA/whole blood samples were collected to isolate DNA by rapid non-enzymatic method [23], from 331 patients (110- NC; 110- CC and 111- PSC) and 210 healthy normal individuals for conducting Polymerase Chain Reaction (PCR), Single-Strand Conformation Polymorphism (SSCP), Sequencing and Restriction Fragment Length Polymorphism (RFLP).

17 sets of primers were designed for amplifying 10 exons along with intronic boundaries of IDO gene and their annealing temperatures used for PCR amplification are given in Table 1. SSCP analysis was carried out by running the samples on 10– 12% Polyacrylamide denaturing gels prepared by using 40% acrylamide solution (37.5g acrylamide, 1g bis-acrylamide), and the run was carried out at 100 V for 12-18 h. Later the gels were stained by silver staining and bands were visualized by Systronics gel documentation. Samples showing mobility shift in banding pattern was sequenced to identify the nucleotide variation through the commercial source (Vimta Labs Pvt Ltd, Hyderabad) using ABI 3100 genetic analyzer.

Later, RFLP analysis was planned to genotype the sequence variants identified by sequencing. Restriction enzymes for RFLP were selected using the web-based program NEB cutter v.2.0 from New England Biolabs (http://tools.neb.com /NEBcutter2/). The enzymes used for RFLP genotyping were HhaI for the variants identified in exon 7 and intron 4, AatII for exon 9, BseMI and AciI for promoter variants viz..c.-979 G>A and c.-471T>G respectively (Table 2). For RFLP genotyping 5μl of amplified PCR products were digested with 1-3 units of the restriction enzyme and incubated overnight at 37°C. Then Electrophoresis (2%Agarose/ 8-10%PAGE) was used to separate the PCR products digested by the restriction enzymes.

Different bioinformatic tools like CLUSTAL X (http:// www.softpedia.com/get/Science-CAD/Clustal-X.shtml), Polymorphism Phenotyping (Polyphen; http://genetics.bwh. harvard.edu/pph2/), Sorting Intolerant From Tolerant (SIFT; http://sift.jcvi.org/), and Human splicing finder (HSF; http:// www.umd.be/HSF/) were employed to study the importance of variants associated with ACRs.

For protein modeling Rasmol and Swiss probe dbv viewer were used for mutational analysis to analyze the effect of mutation on the structure of the protein. The mutants were modeled by using the Triton v.4.0.0 package. Triton uses the methodology of computational site-directed mutagenesis and the in silico testing of mutant properties. The 3D structure of mutant was generated by the Modeller V9v3 program. This program uses the method of comparative protein modeling by satisfaction of spatial restrains to model structures of homology proteins based on the 3D structure of template protein.

The Epidemiological data of the present study showed high preponderance of female patients (NC:50.9%; CC:54.5%; PSC:60.4%) as compared to males (NC:49.1%; CC:45.5%; PSC:39.6%) indicating high risk for females for developing age related cataracts. The ages of the patients selected for this study were falling within the range of 40 to 85 yrs and the controls were within 40 to 80 yrs. The mean ages were recorded as 61.3±0.23 for NC, 58.1±0.23 for CC, and 56.6±0.22 for PSC patients and 49.1±0.10 for controls. The mean age at onset of cataract revealed early onset for the subjects with PSC (55.6±0.22) followed by CC (57.5±0.23) and NC (60.4± 0.23) cases.

Sequencing of variant samples identified by SSCP screening of all the 10 exons and intronic boundaries of IDO gene revealed the presence of 4 genetic variants (two Novel: c.596_597delinsTT in exon 7; c.822C>T in exon 9 and two known: c.422+90G>A in intron 4; (-/CAA) del in intron 8) (Table 3).

Novel variants in exon 7 and 9 of IDO gene

The novel variant c.596_597delinsTT identified in exon 7 has been registered in NCBI as rs267606590. It was found in heterozygous state among two of the cases (one with NC and one with CC) studied and none among controls. The two probands with this variation were males with an age at onset of 59 and 45 years respectively. The deletion (CG) and insertion (TT) of two successive nucleotides at c.596 and c.597 positions causes codon change leading to substitution of alanine (A) at position 199 by valine (V) in variants. This variation p.A199V showed loss of site for HhaI enzyme.

Alignment of IDO amino acid sequence from several species using CLUSTAL X showed high conservation for amino acid Alanine at 199 position. SIFT and PolyPhen tools predicted “probable damaging effect” with PSIC score of 1.53 by the variant on protein function and with a significant SIFT score of 0.00. Superimposition of IDO mutant and wild type proteins (2DOT) by Triton package showed RMSD value of 1.19, which indicated wide variation between the wild type and mutant protein structure. The functional study of this variant is understudy for its further characterization in-vitro.

The other novel variant identified in exon 9 showed C to T transition in heterozygous condition at c.822 of IDO gene. It was found in one of the control subjects as synonymous mutation coding for aspartic acid at 274th position of the protein. As per codon usage table the variant showed 46% of accessibility during protein synthesis. This variation resulted in the loss of restriction site for the enzyme Aat II. HSF predicted the break of potential branch point in variants, and ESE and EIE predicted destruction of enhancer site with a score of -100.

Known variants in intron 4 and 8 of IDO gene

c.422+90 G>A (rs4613984) transition was found in intronic region lying between exon 4 and 5 and is identified in six samples (3 with NC and 3 with PSC) that correlated with homo and heterozygous patterns. This transition caused loss of site of HhaI enzyme resulting in homozygosity in one patient (with NC) and heterozygosity in 5 patients (2 with NC and 3 with PSC). This known variation was not found in controls. HSF did not predict any effect on potential splice site/branch point with this variation, but showed destruction of two enhancer sites with a score of -100 and creation of a new silencer motif with a variation score of -16.23.

Another known variation rs3214412 showing (-/CAA) deletion in intron 8 was found both among cases and controls of the present study indicating the polymorphic nature of the variation found. The frequency of heterozygotes (ID) was high in PSC (10.8%) as compared to NC (7.3%), CC (5.5%) cases and controls (5.7%). Estimate of odds ratio showed protection for wild type allele ‘I’ (OR= 0.43; 95%CI =0.18-1.02; P=0.03) in PSC cases while variant allele ‘D’ showed 2 fold risk (OR= 2.28; 95%CI =1.01-5.38; P=0.03) for developing PSC. The bioinformatic tools, EIEs and PESE octomer from Zhang and Chasin predicted destruction of enhancer site with a variation score of -100.

Sequence variations detected in 1.3kb promoter of IDO gene

Screening for variations in promoter of IDO gene revealed the presence of 3 variants - two novel (c.-979 G>A & c.-471 T>G) and one known variant (c.-738 A>G) (Table 4).

Novel variants

The novel variant c.-979 G>A (NCBI reference number is rs267606591) was found in two of the cases (1 with NC & 1 with PSC), resulting in the loss of GATA2 transcription factor binding site. This variation created a restriction site for BseMI enzyme. 

The presence of another novel variant c.-471 T>G in the promoter region was identified in 3 PSC cases. It has been registered in NCBI SNP database as rs267606592.The variantallele created two SPIB and ETS1 transcription factor binding sites. Wild type allele ‘T’ didn’t show the presence of TFBs.

Known variant

A known variant rs118067147 (c.-738A>G) in heterozygous pattern was found in three of 331 cataract cases (2NC and 1PSC) and in one of 210 controls. Wild type allele ‘A’ showed the presence of 2 TFBs, FOXC1 and SOX10 sites. Variant allele ‘G’ showed the presence of binding site for FOXC1 only with a lesser threshold value of 94% and loss of SOX10 site when compared to normal allele ‘A’.

Table 1: List of Primers and annealing temperatures used to amplify all the 10exons and 1.3kb promoter sequence of IDO gene.

IDO gene exonic regions
Region	Sequence (5’-3’)	Oligo (bp)	Product (bp)	Annealing
Exon 1	F- CAAAAGTGGAAGTAATTTCTCAC	23	285
	R- GAAGTTAACTTGGCCAGGTAAG	22
Exon 2-3	F- GAAGGCAAGGCATACTATCAG	21	365
	R-GGAAAGTTAAATGTAAATTAGATG	24
Exon 4	F- CAGGAGCAAGACTCCATCTC	20	378
	R- GTAGTGGTAGACACAGCAGTC	21
Exon 5	F- GCTTTTTCTTTTTACCTATGTCTTACC	27	228
	R- TGGAGTCTATTGATAAACCTACATTCA	27
Exon 6	F- GATAGTAAGGCCTGCCACAC	20	297
	R- GTTTAGGCTCCGAAGTGATTG	21
Exon 7	F- CTGGACAACTGAGCGAGACTC	21	273
	R- CTATTCTACACCTGGAACATTTG	23
Exon 8	F- CATTATCAGTTGTACACAACACC	23	215
	R- GGATATTAGGGACCAACCAAG	21
Exon 9	F- GGATCATGAAATCCATCTCTTG	22	339
	R- GTGCTTTGTAGATATCCAAATAC	23
Exon 10a	F- CAGTGAATGCTATATTGGTGATC	23	298
	R- GCAGATGGTAGCTCCTCAGG	20
Exon 10b	F- CCTGAGGAGCTACCATCTGC	20	252
	R- GTAATGACAGGAATGCATACAG	22
IDO gene promoter region
Region 1	F- TTCCTTGAACTGATTCCCAAA	21	218
	R- GCATATGGCTTTCGTTACAGTC	22
Region 2	F- AGTAGAGAATAGCGCGAGAGC	21	245
	R- GCATGCAAGTCTGTGGTTCA	20
Region 3	F- AACGGGCAACTTGGTTTCTT	20	297
	R- AGCATTTGCCCTTCTCACAT	20
Region 4	F- CCCGCAGTCAGGTACAGTTAG	21	250
	R- AAAATATTAGTGTCATGTTTCAGCA	25
Region 5	F- TTTCCTACTTCAGAGCCATTGAC	23	250
	R- CAGAAAGGCCTGAAGGAAAAC	21
Region 6	F- TTTCCATAAAGTAAAATGTTCTTCTCC	27	234
	R- TCCACTTTTGGAATGGTTTCA	21
Region 7	F- GCACAGAGATGCTTTTGTGG	20	207
	R- TGTGCCATTCTTGTAGTCTGCT	22

Table 2: RFLP analysis for variants detected in IDO gene.

Table 3: Frequency of sequence variations detected in exons with intronic boundaries of IDO gene in probands with ARCs and controls.

Table 4: Frequency of sequence variations detected in promoter of IDO gene in probands with ARCs and controls

Age-related cataract is a multi-factorial condition responsible for 51% of world blindness, which represents about 20 million people [25]. Nearly about 20 genes are indicated to be involved in the development of ARCs (http://cat-map.wustl.edu/) [26]. Recently, IDO gene has also been included in the database based on a preliminary study conducted by our group [27], which identified the IDO gene variations causing susceptibility to ARC specially revealing significant association of c.422+90G>A (rs4613984) variation with the disease - a first report

Till now very few studies were available on IDO genetic variants. A general study by Arefayene et al., (2009) described the frequencies of the IDO gene variants which were identified among 48 African Americans and 48 Caucasian Americans. Functional studies revealed the reduced and loss of IDO activity in two of the variants studied by the authors. Two other clinical studies conducted with reference to pre-eclampsia and recurrent spontaneous abortions showed lack of their association with IDO gene variants [20,21]. Till date, studies are not available regarding the genetic variation of IDO gene causing cataracts except for our reports [22,27]. Of the variants identified by our study, c.596_597delinsTT variant showed adverse effect on IDO function by altering its structure. Due to this, the loss or reduced enzyme activity may further influence the rate of UV filter synthesis. The two variants identified in intronic region (c.422+90 G>A in intron 4 and -/CAA deletion in intron 8) though are not found to affect the potential splice site or branch point directly, they are likely to destruct the enhancer motifs of splicing. Thus these variations may be affecting splicing process leading to alteration of post translational modification of IDO protein. The creation or destruction of transcription factor binding sites by variants identified in the promoter of IDO gene, could possibly be affecting the regulation of IDO expression. This has to be further confirmed by in vitro functional studies.

Observations made by the present investigation indicate the role of IDO genetic variants in the formation of different types of cataracts due to alteration in the structure and function of IDO protein – a vital component required for the normal synthesis and action of UV filters that are responsible to maintain lens transparency and clear vision. We recommend further studies in this line among different populations will help in better understanding the role of IDO gene variants and its product in developing ARCs.

The authors are thankful to all the subjects who voluntarily extended their cooperation in this study and also the doctors for their help in proper diagnosis of a case for the study

This work was funded by Indian Council of Medical Research (ICMR) (SAN. File No.45/10/2011 /HUM- BMS), New Delhi, India.

1. Munn DH, ZhouM, Attwood JT, Bondarev I, Conway SJ, Marshall B, et al. Prevention of allogeneic fetal rejection by tryptophan catabolism. Science. 1998; 281: 1191–1193.

2. Li Y, Tredget EE, Ghaffari A, Lin X, Kilani RT, Ghahary A. Local expression of indoleamine 2,3-dioxygenase protects engraftment of xenogeneic skin substitute. J Invest Dermatol. 2006; 12: 128-136.

3. Brandacher G, Margreiter R, Fuchs D. Implications of IFN-gammamediated tryptophan catabolism on solid organ transplantation. Curr Drug Metab. 2007; 8: 273-282.

4. Zhu BT. Development of selective immune tolerance towards the allogeneic fetus during pregnancy: Role of tryptophan catabolites (Review). Int J Mol Med. 2010; 25: 831–835.

5. Muller AJ, DuHadaway JB, Donover PS, Sutanto-Ward E, Prendergast GC. Inhibition of indoleamine 2,3-dioxygenase, an immunoregulatory target of the cancer suppression gene Bin1, potentiates cancer chemotherapy. Nat Med. 2005; 11: 312–319.

6. Macchiarulo A, Camaioni E, Nuti R, Pellicciari R. Highlights at the gate of tryptophan catabolism: a review on the mechanisms of activation and regulation of indoleamine 2,3-dioxygenase (IDO), a novel target in cancer disease. Amino Acids. 2009; 37: 219–229.

7. Lesch KP, Gutknecht L. Pharmacogenetics of the serotonin transporter. Prog Neuropsychopharmacol Biol Psychiatry. 2005; 29: 1062–1073.

8. Nemeth H, Toldi J, Vecsei L. Kynurenines, Parkinson’s disease and other neurodegenerative disorders: preclinical and clinical studies. J Neural Transm Suppl. 2006; 70: 285–304.

9. Nemeth H, Robotka H, Toldi J, Vecsei L. Kynurenines in the central nervous system: recent developments. Central Nervous System Agents in Medicinal Chemistry. Formerly Current Medicinal. 2007; 7: 45–56.

10. Oxenkrug GF. Interferon-gamma-inducible kynurenines/pteridines inflammation cascade: implications for aging and aging-associated psychiatric and medical disorders. J Neural Transm. 2011; 118: 75–85.

11. Bova LM, Sweeney MH, Jamie JF, Truscott RJW. Major changes in human ocular UV protection with age. Invest ophthalmol Vis sci. 2001; 42: 200-205.

12. Hood BD, Garner B, Truscott RJW. Human lens coloration and aging. Evidence for crystallin modification by the major ultraviolet filter, 3– hydroxykynurenine glucoside. J Biol Chem. 1999; 274: 32547–32550.

13. Vazquez S, Aquilina JA, Jamie JF, Sheil MM, Truscott RJW. Novel protein modification by kynurenine in human lenses. J Biol Chem. 2002; 277: 4867–4873.

14. Bova LM, Wood AM, Jamie JF, Truscott RJW. UV filter compounds in human lenses: the origin of 4-(2-amino-3-hydroxyphenyl)-4- oxobutanoic acid O-β-D-glucoside. Invest Ophthalmol Vis Sci. 1999; 40: 3237–3244.

15. Truscott RJW, Wood AM, Carver JA, Sheil MM, Stutchbury GM, Zhu J, et al. A new UV-filter compound in human lenses. FEBS Letters. 1994; 348: 173-176.

16. Garner B, Vazquez S, Griffith R, Lindner RA, Carver JA, Truscott RJW. Identification of glutathionyl-3-hydroxykynurenine glucoside as a novel fluorophore associated with aging of the human lens. J Biol Chem. 1999; 274: 20847-20854.

17. Chon SY, Hassanain HH, Gupta SL. Cooperative role of interferon regulatory factor 1 and p91 (STAT1) response elements in interferongammainducible expression of human indoleamine 2,3-dioxygenase gene. J Biol Chem. 1996; 271: 17247–17252.

18. Robinson CM, Hale PT, Carlin JM. NF-kappa B activation contributes to indoleamine dioxygenase transcriptional synergy induced by IFNgamma and tumor necrosis factor-alpha. Cytokine. 2006; 35: 53–61.

19. Arefayane M, Philips S, Cao D, Mamidipalli S, Desta Z, Flockhart DA, et al. Identification of genetic variants in the human indoleamine [IDO1] gene, which have altered enzyme activity. Pharmacogenet Genomics. 2009; 19: 464-476.

20. Nishizawa H, Kato T, Ota S, Nishiyama S, Pryor-Koishi K, Suzuki M, et al. Genetic variation in the indoleamine 2,3-dioxygenase gene in preeclampsia. Am J Reprod Immunol. 2010; 64: 68-76.

21. Amani D, Fatemeh R, norrio N, Ko-ichiro Y, Mojtaba K, Alamtaj SD, et al. Coding region polymorphisms in the indoleamine 2,3-dioxygenase (INDO) gene and recurrent spontaneous abortion. J of reprod immunol. 2011; 88: 42-47.

22. Mamata M, Sridhar G, Ravi Kumar Reddy K, Nagaraju T, Padma T. Is the variant c.422+90G→A in intron 4 of indoleamine 2, 3 -dioxygenase (IDO) gene related to age related cataracts? Mol Vis. 2011; 17: 1203– 1208.

23. Lahiri DK, Nurnberger JI. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res. 1991; 19: 5444.

24. Chylack LT, Wolfe JK, Singer DM, Leske MC, Bullimore MA, Bailey IL, et al. The Lens Opacities Classification System III. The Longitudinal Study of Cataract Study Group. Arch Ophthalmol. 1993; 111: 831-836.

25. Pascolini D, Mariotti SP. Global estimates of visual impairment: 2010. Br J Ophthalmol. 2012; 95: 614–618.

26. Shiels A, Thomas MB, Fielding H. Cat-Map: putting cataract on the map. Mol Vis. 2010; 16: 2007–2015.

27. Mamata M, Padma G, Swapna N, Padma T. Genetic Variations in the Promoter Region of IDO Gene Associated with Age-Related Cataracts. Online International Interdisciplinary Research Journal. 2014; 4: 13- 21.

Manne M, Gunda P, Tirunilai P (2017) Initial Investigation Indicating Association of Indoleamine 2,3-Dioxygenase Gene Variants with Age Related Cataracts. JSM Ophthalmol 5(3): 1060.

Exposure to UV is one of the major risk factor for the development of age related cataracts (ARCs). UV filters present in lens protect the lens and retina from UV induced photo-damage and obstruction of normal vision. UV filters are produced by Kynurenine pathway, wherein Indoleamine 2,3-dioxygenase (IDO) is the first rate limiting enzyme. So, the present study was conducted for the first time to screen for the genetic variants of IDO gene causing different types of ARCs. 331 cases [110- Nuclear (NC); 110- Cortical (CC) and 111- Posterior subcapsular cataracts (PSC)] and 210 normal individuals were screened by SSCP, Sequencing and RFLP techniques. In silico analysis was carried out using different bioinformatic tools. The study revealed 2 novel (c.596_597delinsTT in exon 7; c.822C>T in exon 9) and 2 known (c.422+90G>A in intron 4; -/CAA del in intron 8) variants in exon and exon-intron boundaries of IDO gene. Further, 2 novel (c.-979 G>A& c.-471 T>G) and 1 Known (c.-738 A>G) variants were detected in promoter region, affecting the transcription factor binding sites in-silico. The known c.422+90G>A variant having destructive effect on enhancer sites was found in 6 patients (3 NC and 3 PSC) and novel variant (c.596_597delinsTT) in exon 7 of IDO was found in 2 cases (1NC and 1CC), with a probable damaging effect on protein in-silico. CAA deletion in intron 8 was found to be polymorphic, showing 2 fold risk for developing PSC. Exon 9 c.822C>T variant detected only in controls was a silent mutation. The variants associated with ARCresultsin the alteration of the structure and function of IDO protein–a vital component required for normal synthesis and action of UV filters involved in maintaining lens transparency and clear vision. Further studies in this line would confirm the role of IDO gene in developing ARCs.